Direkt zum Inhalt
Merck

EHU076601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGGACCTGAATGAGGAGGAAACCATTCTCATCATCCGGCGTCTCCACAAAGTGCTGCGGCCCTTCTTGCTCCGACGACTCAAGAAGGAAGTCGAGGCCCAGTTGCCCGAAAAGGTGGAGTACGTCATCAAGTGCGACATGTCTGCGCTGCAGCGAGTGCTCTACCGCCACATGCAGGCCAAGGGCGTGCTGCTGACTGATGGCTCCGAGAAGGACAAGAAGGGCAAAGGCGGCACCAAGACCCTGATGAACACCATCATGCAGCTGCGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATCGAGGAGTCCTTTTCCGAGCACTTGGGGTTCACTGGCGGCATTGTCCAAGGGCTGGACCTGTACCGAGCCTCGGGTAAATTTGAGCTTCTTGATAGAATTCTTCCCAAACTCCGAGCAACCAACCACAAAGTGCTGCTGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wentao Sun et al.
European journal of pharmacology, 875, 173038-173038 (2020-02-28)
High glucose (HG)-induced oxidative damage of retinal ganglion cells (RGCs) contributes to the pathogenesis of diabetic retinopathy, a severe complication of diabetes mellitus. Brahma-related gene 1 (Brg1) has currently emerged as a cytoprotective protein that alleviates oxidative damage induced by
Shujie Song et al.
Molecular cancer research : MCR, 18(12), 1777-1788 (2020-08-29)
The NF-E2-related factor 2 (referred to as NRF2) transcription factor binds antioxidant responsive elements within the promoters of cytoprotective genes to induce their expression. Next-generation sequencing studies in lung cancer have shown a significant number of activating mutations within the
Tatiana Souslova et al.
Molecular neurobiology, 54(10), 8263-8277 (2016-12-04)
Five-prime repressor element under dual repression binding protein-1 (Freud-1)/CC2D1A is genetically linked to intellectual disability and implicated in neuronal development. Freud-1 represses the serotonin-1A (5-HT1A) receptor gene HTR1A by histone deacetylase (HDAC)-dependent or HDAC-independent mechanisms in 5-HT1A-negative (e.g., HEK-293) or
Xiaoping Liu et al.
Free radical biology & medicine, 160, 820-836 (2020-09-21)
Brahma-related gene 1 (BRG1) regulates the chromatin structure and expression of cardiac genes. Although BRG1 is downregulated in adult cardiomyocytes, it is reactivated during cardiac stress. The role of BRG1 in acute myocardial infarction (AMI) has not been clearly defined.
Yanru Li et al.
Journal of biochemical and molecular toxicology, 32(4), e22044-e22044 (2018-02-20)
Accumulating evidence has reported that microRNA-144-3p (miR-144-3p) is highly related to oxidative stress and apoptosis. However, little is known regarding its role in cerebral ischemia/reperfusion-induced neuronal injury. Herein, our results showed that miR-144-3p expression was significantly downregulated in neurons following

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.