Direkt zum Inhalt
Merck

EHU074341

Sigma-Aldrich

MISSION® esiRNA

targeting human OXA1L

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AATGTGGGCTGTTCTTGAGCTAGGTGCTGAGACAGGTGTGCAAAGTTCTGACCTTCAGTGGATGAGAAATGTCATCAGAATGATGCCCCTGATAACCTTGCCCATAACCATGCATTTCCCCACGGCAGTGTTTATGTACTGGCTCTCCTCCAATTTGTTTTCCCTGGTCCAAGTATCCTGTCTCCGGATTCCAGCAGTACGCACTGTACTTAAAATCCCCCAGCGTGTTGTACATGACCTGGACAAATTACCTCCACGGGAAGGCTTCCTAGAGAGCTTCAAAAAAGGCTGGAAAAATGCTGAAATGACGCGTCAGCTGCGAGAGCGTGAACAACGCATGCGGAATCAGTTGGAGCTAGCAGCCAGGGGTCCTTTACGACAGACCTTTACCCACAACCCTCTCCTACAACCTGGAAAGGATAACCCTCCCAATATCCCTAGCAGCAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hongfei Chen et al.
Bioengineered, 11(1), 1269-1279 (2020-11-04)
Emerging evidence suggested that circular RNAs (circRNAs) play critical roles in cervical cancer (CC) progression. However, the roles and molecular mechanisms of hsa_circ_0007364 in the tumorigenesis of CC remain unclear. In the present study, we used bioinformatics analysis and a
Wei Liu et al.
Biochemical and biophysical research communications, 500(4), 846-851 (2018-04-27)
Lung cancer characterized with malignant cell growth is the leading cause of cancer-related deaths. In recent years, several circular RNAs (circRNAs) have been reported to participate in lung cancer progression. However, the correlation between circular RNA (circRNA) and lung cancer still
Beibei Shao et al.
Biochemical and biophysical research communications, 513(1), 135-140 (2019-04-05)
Recent studies indicated that circular RNAs (circRNAs) could play critical roles in the initiation and development of tumors, including tongue squamous cell carcinoma (TSCC). We aimed to investigate the roles and underlying mechanisms of hsa_circ_0001742 in TSCC. In the present
Yuhan Chen et al.
Gene, 629, 35-42 (2017-08-05)
Radiation-induced liver fibrosis (RILF) is considered as a major complication of radiation therapy for liver cancer. Circular RNA (circRNA) has been recently identified as a functional noncoding RNA involving in various biological processes. However, the expression pattern and regulatory capacity
Shujun Wu et al.
Biological chemistry, 399(12), 1457-1467 (2018-08-24)
As the most common histological subtype of lung cancer, lung adenocarcinoma remains a tremendous risk to public health, which requires ceaseless efforts to elucidate the potential diagnostic and therapeutic strategies. Circular RNAs (circRNAs) have been identified with emerging roles in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.