Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU067331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM28

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG

Ensembl | Human Hinterlegungsnummer

ENSG00000130726

NCBI-Hinterlegungsnummer

NM_005762

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TRIM28(10155) , TRIM28(10155)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Min Li et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(38), 23588-23596 (2020-09-10)
In human cells, the DNA replication factor proliferating cell nuclear antigen (PCNA) can be conjugated to either the small ubiquitinlike modifier SUMO1 or SUMO2, but only SUMO2-conjugated PCNA is induced by transcription to facilitate resolution of transcription-replication conflict (TRC). To
Hongtao Liu et al.
Chemico-biological interactions, 311, 108772-108772 (2019-07-28)
Atherosclerosis is a common type of cardiovascular disease (CVD), remaining one of the leading causes of global death. Tripartite motif-containing 28 (TRIM28) is a member of TRIM family that has been found to be involved in atherosclerosis. However, the role
Hitoshi Ohtani et al.
Genome research, 28(8), 1147-1157 (2018-07-05)
We provide a comprehensive genomic and epigenomic map of the more than 500,000 endogenous retroviruses (ERVs) and fragments that populate the intergenic regions of the human genome. The repressive epigenetic marks associated with the ERVs, particularly long terminal repeats (LTRs)
Xiao-Hua Zhang et al.
Molecular medicine reports, 23(3) (2021-01-06)
Myocardial ischemia/reperfusion (MIR) injury, which occurs following acute myocardial infarction, can cause secondary damage to the heart. Tripartite interaction motif (TRIM) proteins, a class of E3 ubiquitin ligases, have been recognized as critical regulators in MIR injury. Zenglv Fumai Granule (ZFG) is a
Eun Kyoung Do et al.
Cell death and differentiation, 28(2), 685-699 (2020-09-09)
Oct4 plays a crucial role in the regulation of self-renewal of embryonic stem cells (ESCs) and reprogramming of somatic cells to induced pluripotent stem cells. However, the molecular mechanisms underlying posttranslational regulation and protein stability of Oct4 remain unclear. Using
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.