Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU062441

Sigma-Aldrich

MISSION® esiRNA

targeting human SEPT9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCCAGGAGGCCACTGAGGCGGCTCCCAGCTGCGTTGGCGACATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTGGACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTCGAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAATCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAGTCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTCGGGGACCACATCAACAACGAGAACTGCTGG

Ensembl | Human Hinterlegungsnummer

ENSG00000184640

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SEPT9(10801) , SEPT9(10801)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Beatrice Stubendorff et al.
Journal of cancer research and clinical oncology, 145(4), 811-820 (2019-01-04)
In this study, we aimed to identify a DNA methylation pattern suitable for prognosis assessment of muscle-invasive bladder cancer and to investigate metastasis-associated processes regulated by DNA methylation. Genome-wide methylation analysis was performed on 23 muscle-invasive bladder tumors by microarray
Forooz Soroor et al.
Molecular biology of the cell, 32(3), 289-300 (2020-12-03)
Septins are conserved GTP-binding cytoskeletal proteins that polymerize into filaments by end-to-end joining of hetero-oligomeric complexes. In human cells, both hexamers and octamers exist, and crystallography studies predicted the order of the hexamers to be SEPT7-SEPT6-SEPT2-SEPT2-SEPT6-SEPT7, while octamers are thought
Guodong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109768-109768 (2020-02-29)
Malignant glioma is a highly aggressive cancer, known as one of the most dangerous types of primary brain tumor occurring in the central nervous system (CNS). Septin 9 (SEPT9) has been involved in tumor growth. However, its exact roles in
Ilona A Kesisova et al.
The Journal of cell biology, 220(2) (2021-01-09)
The metabolic and signaling functions of lysosomes depend on their intracellular positioning and trafficking, but the underlying mechanisms are little understood. Here, we have discovered a novel septin GTPase-based mechanism for retrograde lysosome transport. We found that septin 9 (SEPT9)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.