Direkt zum Inhalt
Merck

EHU047961

Sigma-Aldrich

MISSION® esiRNA

targeting human GRK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAGGTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGACGTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTGGAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGGGGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAGTGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGCATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xuezhi Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 110, 834-843 (2018-12-18)
CP-25 attenuates arthritis progression in animal models by inhibiting G protein-coupled receptor kinase 2 (GRK2) membrane expression. This study compared groups treated with high-dose methotrexate (MTX)/leflunomide (LEF) and CP-25 combined with low-dose MTX/LEF in an adjuvant-induced arthritis (AA) rat model
Xuezhi Yang et al.
Cells, 8(12) (2019-12-11)
Rheumatoid arthritis (RA) is characterized by the massive infiltration of various chronic inflammatory cells in synovia. In synovial fluid of patients with RA, M1 macrophages are dominant among all subtypes of macrophages, the mechanisms of macrophages polarization imbalance in RA
Jie Xu et al.
Nature communications, 8, 14002-14002 (2017-01-17)
β-TrCP and SKP2 are two well-studied F-box proteins, which often act as oncogenes. Whether and how they communicate with each other is unknown. Here we report that FBXW2, a poorly characterized F-box, is a substrate of β-TrCP1 and an E3
Jing Cheng et al.
The Journal of clinical investigation, 130(2), 1036-1051 (2020-01-22)
Antigen receptor-dependent (AgR-dependent) stimulation of the NF-κB transcription factor in lymphocytes is a required event during adaptive immune response, but dysregulated activation of this signaling pathway can lead to lymphoma. AgR stimulation promotes assembly of the CARMA1-BCL10-MALT1 complex, wherein MALT1

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.