Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU047751

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CL1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCACCTTCTGCCATCTGACTGTCCTGCTGGCTGGACAGCACCACGGTGTGACGAAATGCAACATCACGTGCAGCAAGATGACATCAAAGATACCTGTAGCTTTGCTCATCCACTATCAACAGAACCAGGCATCATGCGGCAAACGCGCAATCATCTTGGAGACGAGACAGCACAGGCTGTTCTGTGCCGACCCGAAGGAGCAATGGGTCAAGGACGCGATGCAGCATCTGGACCGCCAGGCTGCTGCCCTAACTCGAAATGGCGGCACCTTCGAGAAGCAGATCGGCGAGGTGAAGCCCAGGACCACCCCTGCCGCCGGGGGAATGGACGAGTCTGTGGTCCTGGAGCCCGAAGCCACAGGCGAAAGCAGTAGCCTGGAGCCGACTCCTTCTTCCCAGGAAGC

Ensembl | Human Hinterlegungsnummer

ENSG00000006210

NCBI-Hinterlegungsnummer

NM_002996

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CX3CL1(6376) , CX3CL1(6376)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ju-Fang Liu et al.
Oncotarget, 8(33), 54136-54148 (2017-09-15)
Osteosarcoma is the most common primary bone tumor in children and teens. The exact molecular mechanism underlying osteosarcoma progression still remains unclear. The CX3CL1/fractalkine has been implicated in various tumors but not in osteosarcoma. This study is the first to
Claudia Geismann et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignant neoplasms and registers rising death rates in western countries. Due to its late detection in advanced stages, its extremely aggressive nature and the minimal effectiveness of currently available therapies
Feifei Ren et al.
Immunology and cell biology, 97(5), 457-469 (2018-12-24)
Mutations in the isocitrate dehydrogenase (IDH) 1 gene, especially the R132H mutation, have been reported to be associated with a better prognosis in glioma patients. However, the underlying molecular mechanisms are not yet well understood. Many factors may contribute to
Monika Siwetz et al.
The American journal of pathology, 185(5), 1334-1343 (2015-03-15)
The pathogenesis of preeclampsia (PE) includes the release of placental factors into the maternal circulation, inducing an inflammatory environment in the mother. One of the factors may be the proinflammatory chemokine fractalkine, which is expressed in the syncytiotrophoblast of human
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.