Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU039411

Sigma-Aldrich

MISSION® esiRNA

targeting human SAG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTGCGGTCTCTCTCAACAAAGAGATCTATTTCCATGGGGAGCCCATCCCTGTGACCGTGACTGTCACCAATAACACAGAGAAGACCGTGAAGAAGATTAAAGCATTCGTGGAACAGGTGGCCAATGTGGTTCTCTACTCGAGTGATTATTACGTCAAGCCCGTGGCTATGGAGGAAGCGCAAGAAAAAGTGCCACCAAACAGCACTTTGACCAAGACGCTGACGCTGCTGCCCTTGCTGGCTAACAATCGAGAAAGGAGAGGCATTGCCCTGGATGGGAAAATCAAGCACGAGGACACAAACCTTGCCTCCAGCACCATCATTAAGGAGGGCATAGACCGGACCGTCCTGGGAATCCTGGTGTCTTACCAGATCAAGGTGAAGCTCACAGTGTCAGGCTTGGGAGAGA

Ensembl | Human Hinterlegungsnummer

ENSG00000130561

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SAG(6295) , SAG(6295)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Taehyung Lee et al.
Journal of cellular physiology, 231(5), 992-1000 (2015-10-20)
β-Arrestins are multifunctional scaffolding proteins that modulate G protein-coupled receptor (GPCR)-dependent and -independent cell signaling pathways in various types of cells. We recently demonstrated that β-arrestin1 (β-arr1) deficiency strikingly attenuates dextran sodium sulfate (DSS)-induced colitis in mice. Since DSS-induced colitis
Zhi-Yu Song et al.
Oncogene, 38(9), 1560-1575 (2018-10-20)
Both chemokine receptors (CXCRs) 7 and 4 can facilitate immune cell migration and mediate a vast array of physiological and pathological events. Herein we report, in both human and animal studies, that these two CXCRs can form heterodimers in vivo
Benedetta Assetta et al.
Cell reports, 27(7), 1960-1966 (2019-05-16)
JC polyomavirus (JCPyV) is a ubiquitous human pathogen that causes progressive multifocal leukoencephalopathy (PML). The entry receptors for JCPyV belong to the 5-hydroxytryptamine 2 receptor (5-HT2R) family, but how individual members of the family function to facilitate infection is not
Colleen L Mayberry et al.
Journal of virology, 93(8) (2019-02-01)
JC polyomavirus (JCPyV) establishes a persistent, lifelong, asymptomatic infection within the kidney of the majority of the human population. Under conditions of severe immunosuppression or immune modulation, JCPyV can reactivate in the central nervous system (CNS) and cause progressive multifocal
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.