Direkt zum Inhalt
Merck

EHU035401

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL16

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGCTTACTCGGGGATTGTGGCCCACCAGAAGCATTTACTTCCTACCAGCCCCCCAATTTCTCAGGCCTCAGAGGGGGCATCTTCAGATATCCACACCCCTGCCCAGATGCTCCTGTCCACCTTGCAGTCCACTCAGCGCCCCACCCTCCCAGTAGGATCACTGTCCTCGGACAAAGAGCTCACTCGTCCCAATGAAACCACCATTCACACTGCGGGCCACAGTCTGGCAGCTGGGCCTGAGGCTGGGGAGAACCAGAAGCAGCCGGAAAAAAATGCTGGTCCCACAGCCAGGACATCAGCCACAGTGCCAGTCCTGTGCCTCCTGGCCATCATCTTCATCCTCACCGCAGCCCTTTCCTATGTGCTGTGCAAGAGGAGGAGGGGGCAGTCACCGCAGTCCTCTCCAGATCTGCCGGTTCATTATATACCTGTGGCACCTGACTCTAATACCTGAGCCAAGAATGGAAGCTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhenzhen Ma et al.
Respiratory research, 22(1), 42-42 (2021-02-08)
Alveolar epithelial cells play an essential role in the initiation and progression of pulmonary fibrosis, and the occurrence of epithelial-mesenchymal transition (EMT) may be the early events of pulmonary fibrosis. Recent studies have shown chemokines are involved in the complex
Kun Ling Ma et al.
American journal of translational research, 10(6), 1802-1816 (2018-07-19)
Non-alcoholic fatty liver disease (NAFLD), characterised by early lipid accumulation and subsequent inflammation in the liver, is becoming a worldwide challenge due to its increasing prevalence in developing and developed countries. This study aimed to investigate the role of CXC
Audrey Dieudonné et al.
PloS one, 7(8), e41952-e41952 (2012-08-11)
Scavenger receptors and Toll-like receptors (TLRs) cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (ds)RNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed
Ze-Bo Hu et al.
Acta pharmacologica Sinica, 39(6), 1022-1033 (2018-04-06)
Inflammation and lipid disorders play crucial roles in synergistically accelerating the progression of diabetic nephropathy (DN). In this study we investigated how inflammation and lipid disorders caused tubulointerstitial injury in DN in vivo and in vitro. Diabetic db/db mice were
Yijie Zhang et al.
Pathology, research and practice, 216(5), 152913-152913 (2020-03-17)
CXC chemokine ligand 16 (CXCL16) has been reported to exacerbate acute kidney injury induced by ischemia-reperfusion (IR). This study aimed to investigate the probable role of CXCL16 in hepatic IR injury during liver transplantation. The expression patterns of CXCL16 and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.