Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU032631

Sigma-Aldrich

MISSION® esiRNA

targeting human DCTN4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAAGAAACTGGCACGACGTAGAAACTATATGCCTCTGGCTTTTTCGGACAAATATGGTCTTGGAACCAGGCTTCAGCGACCACGAGCTGGTGCATCCATCAGTACCCTTGCCGGACTTTCCCTTAAAGAAGGAGAGGATCAGAAAGAGATAAAGATTGAGCCAGCTCAGGCTGTGGATGAAGTGGAACCTCTACCTGAAGACTATTATACAAGACCAGTAAATTTAACAGAGGTAACAACCCTTCAGCAGCGTCTGTTACAGCCTGACTTCCAGCCAGTCTGTGCTTCACAGCTCTATCCTCGCCACAAACATCTTCTGATCAAACGGTCCCTGCGCTGCCGTAAATGTGAACATAATTTGAGCAAGCCAGAATTTAACCCAACGTCAATCAAATTCAAAATCCAGCTGGTCG

Ensembl | Human Hinterlegungsnummer

ENSG00000132912

NCBI-Hinterlegungsnummer

NM_016221

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... DCTN4(51164) , DCTN4(51164)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Young-Ok Son et al.
The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
Ashwani Khurana et al.
Oncotarget, 6(34), 36354-36369 (2015-10-27)
A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.