Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU025411

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH13

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGCCCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAAACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAAGACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGGTCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAGGTAGTCGATAGTGACAGGCCAGAAAGGTCCAAGTTCCGGCTCACTGGAAAGGGAGTGGATCAAGAGCCTAAAGGAATTTTCAGAATCAATGAGAACACAGGGAGCGTCTC

Ensembl | Human Hinterlegungsnummer

ENSG00000140945

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CDH13(1012) , CDH13(1012)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuya Fujishima et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(4), 1571-1583 (2017-01-08)
Adiponectin, an adipocyte-derived protein abundant in the circulation, is thought to be protective against atherosclerosis. However, it is not fully understood how the association of adiponectin with vascular cells and its antiatherogenic effect are connected. In this study, T-cadherin was
Yuri Tsugawa-Shimizu et al.
American journal of physiology. Endocrinology and metabolism, 320(2), E179-E190 (2020-12-08)
Adiponectin (APN) is a circulating protein specifically produced by adipocytes. Native APN specifically binds to T-cadherin, a glycosylphosphatidylinositol-anchored protein, mediating the exosome-stimulating effects of APN in endothelial, muscle, and mesenchymal stem cells. It was previously reported that APN has beneficial
Keisuke Matsuda et al.
Endocrinology, 156(3), 934-946 (2014-12-17)
Adiponectin (Adipo), a multimeric adipocyte-secreted protein abundant in the circulation, is implicated in cardiovascular protective functions. Recent work documented that Adipo locally associates with responsive tissues through interactions with T-cadherin (Tcad), an atypical, glycosylphosphatidylinositol (GPI)-anchored cadherin cell surface glycoprotein. Mice
Yuki Fujita et al.
Cell reports, 31(4), 107580-107580 (2020-04-30)
Microglia, the resident immune cells of the central nervous system, accumulate along subcerebral projection axons and support neuronal survival during the early postnatal period. It remains unknown how microglia follow an axon-specific distribution pattern to maintain neural circuits. Here, we

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.