Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

View All Documentation

EHU010941

Sigma-Aldrich

MISSION® esiRNA

targeting human CYBB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTTGTGGCTGTGATAAGCAGGAGTTTCAAGATGCGTGGAAACTACCTAAGATAGCGGTTGATGGGCCCTTTGGCACTGCCAGTGAAGATGTGTTCAGCTATGAGGTGGTGATGTTAGTGGGAGCAGGGATTGGGGTCACACCCTTCGCATCCATTCTCAAGTCAGTCTGGTACAAATATTGCAATAACGCCACCAATCTGAAGCTCAAAAAGATCTACTTCTACTGGCTGTGCCGGGACACACATGCCTTTGAGTGGTTTGCAGATCTGCTGCAACTGCTGGAGAGCCAGATGCAGGAAAGGAACAATGCCGGCTTCCTCAGCTACAACATCTACCTCACTGGCTGGGATGAGTCTCAGGCCAATCACTTTGCTGTGCACCATGATGAGGAGAAAGATGTGATCACAGGCCTGAAACAAAAGACTTTGTATGGACGGCCCAACTGGGATAATGAATTCAAGACAATTGCAAGTCAACACCCTAATACCAGAATAGGAGTTTTCCTCTGTGGACCTGAAGC

Ensembl | Human Hinterlegungsnummer

ENSG00000165168

NCBI-Hinterlegungsnummer

NM_000397

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CYBB(1536) , CYBB(1536)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wenjun Wang et al.
Brain research bulletin, 160, 141-149 (2020-05-12)
Sleep deprivation (SD) can induce cognitive and memory impairments. This impairment is in part due to oxidative stress damage in the hippocampus region of the brain. Corilagin (CL), a polyphenol belonging to the tannin family and extracted from Terminalia chebula
Xianzhang Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 783-797 (2018-10-15)
Peri-operative cerebral ischemia reperfusion injury is one of the most serious peri-operative complications that can be aggravated in patients with diabetes. A previous study showed that microglia NOX2 (a NADPH oxidase enzyme) may play an important role in this process.
Young-Mee Kim et al.
American journal of physiology. Cell physiology, 312(6), C749-C764 (2017-04-21)
Reactive oxygen species (ROS) derived from NADPH oxidase (NOX) and mitochondria play a critical role in growth factor-induced switch from a quiescent to an angiogenic phenotype in endothelial cells (ECs). However, how highly diffusible ROS produced from different sources can
Jing Li et al.
Pathology, research and practice, 214(7), 925-933 (2018-06-03)
Aberrant proliferation and migration of retinal pigment epithelium (RPE) cells contributes to the pathology of various ocular diseases. miR-27b has been reported to be crucial in the regulation of cell differentiation, proliferation, apoptosis, and migration. However, the role of miR-27b
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.