Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU004421

Sigma-Aldrich

MISSION® esiRNA

targeting human BMI1, COMMD3-BMI1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAGAACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGATAAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCACTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAGTCTCCTCATCCA

Ensembl | Human Hinterlegungsnummer

ENSG00000168283

NCBI-Hinterlegungsnummer

NM_005180

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... BMI1(100532731) , BMI1(648)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

M Hiraki et al.
Oncogene, 36(20), 2791-2801 (2016-11-29)
B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) is a component of the polycomb repressive complex 1 (PRC1) complex that is overexpressed in breast and other cancers, and promotes self-renewal of cancer stem-like cells. The oncogenic mucin 1 (MUC1)
Fan Xu et al.
Experimental and therapeutic medicine, 14(3), 2216-2220 (2017-10-01)
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin
Valentina Casa et al.
Human molecular genetics, 26(4), 753-767 (2017-01-04)
Repression of repetitive elements is crucial to preserve genome integrity and has been traditionally ascribed to constitutive heterochromatin pathways. FacioScapuloHumeral Muscular Dystrophy (FSHD), one of the most common myopathies, is characterized by a complex interplay of genetic and epigenetic events.
M H Shahi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15107-15114 (2016-09-25)
Chemoresistance is a common hurdle for the proper treatment of gliomas. The role of Shh-Gli1 signaling in glioma progression has been reported. However, its role in glioma chemoresistance has not been well studied yet. In this work, we found that
Hexiang Wang et al.
Biochemical and biophysical research communications, 537, 22-28 (2021-01-01)
Triple-negative breast cancer (TNBC) is a major challenge in clinical practice due to its aggressiveness and lack of targeted treatment. Cancer stem-like traits contribute to tumorigenesis and immune privilege of TNBC. However, the relationship of stemness and immunosurveillance remains unclear.
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.