Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU012051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnf

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGAAGGGAATGGGTGTTCATCCATTCTCTACCCAGCCCCCACTCTGACCCCTTTACTCTGACCCCTTTATTGTCTACTCCTCAGAGCCCCCAGTCTGTGTCCTTCTAACTTAGAAAGGGGATTATGGCTCAGAGTCCAACTCTGTGCTCAGAGCTTTCAACAACTACTCAGAAACACAAGATGCTGGGACAGTGACCTGGACTGTGGGCCTCTCATGCACCACCATCAAGGACTCAAATGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAGTGGTCAGGTTGCCTCTGTCTCAGAATGAGGCTGGATAAGATCTCAGGCCTTCCTACCTTCAGACCTTTCCAGACTCTTCCCTGAGGTGC

Ensembl | mouse accession no.

ENSMUSG00000024401

NCBI accession no.

NM_013693

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... TNF(21926) , Tnf(21926)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Valentina Pileczki et al.
International journal of molecular sciences, 14(1), 411-420 (2012-12-25)
Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine involved in the promotion and progression of cancer, including triple negative breast cancer cells. Thus, there is significant interest in understanding the molecular signaling pathways that connect TNF-α with the survival
Hank Cheng et al.
Journal of neuroinflammation, 13, 19-19 (2016-01-27)
The basis for air pollution-associated neurodegenerative changes in humans is being studied in rodent models. We and others find that the ultrafine particulate matter (PM) derived from vehicular exhaust can induce synaptic dysfunction and inflammatory responses in vivo and in
Li Peng et al.
The International journal of artificial organs, 38(10), 565-571 (2015-11-07)
Periprosthetic osteolysis, involving RANK/RANKL/osteoprotegerin (OPG) and TNF-α/NFκB signaling, contributes to bone resorption and inflammation. We constructed lentivirus vectors to inhibit TNF-α and enhance OPG expression and assessed their impacts on wear debris-induced inflammation and osteoclastogenesis in an osteoclast/osteoblast coculture system.
Praveen Thumbikat et al.
PLoS pathogens, 5(5), e1000415-e1000415 (2009-05-05)
Urinary tract infections are the second most common infectious disease in humans and are predominantly caused by uropathogenic E. coli (UPEC). A majority of UPEC isolates express the type 1 pilus adhesin, FimH, and cell culture and murine studies demonstrate
Wenwen Zheng et al.
Molecular pain, 7, 40-40 (2011-05-24)
HIV-associated sensory neuropathy (HIV-SN) is one of the most common forms of peripheral neuropathy, affecting about 30% of people with acquired immune deficiency syndrome (AIDS). The symptoms of HIV-SN are dominated by neuropathic pain. Glia activation in the spinal cord
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico