Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU146741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAPDH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Suzan Ruijtenberg et al.
Nature structural & molecular biology, 27(9), 790-801 (2020-07-15)
Small interfering RNAs (siRNAs) promote RNA degradation in a variety of processes and have important clinical applications. siRNAs direct cleavage of target RNAs by guiding Argonaute2 (AGO2) to its target site. Target site accessibility is critical for AGO2-target interactions, but
Annalucia Carbone et al.
Stem cells international, 2018, 1203717-1203717 (2018-03-14)
We previously found that human amniotic mesenchymal stem cells (hAMSCs) in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE) on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein.
Martin G Nussbaumer et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 3(10), 1600046-1600046 (2016-11-15)
The group II chaperonin thermosome (THS) is a hollow protein nanoparticle that can encapsulate macromolecular guests. Two large pores grant access to the interior of the protein cage. Poly(amidoamine) (PAMAM) is conjugated into THS to act as an anchor for
Wanwen Lan et al.
FEBS letters, 592(7), 1173-1184 (2018-03-08)
Long intergenic noncoding RNAs (lincRNAs) are not fully characterized in disease, although many are involved in controlling differentiation. We discovered and sequenced a novel 4.4 kb human lincRNA called linc-9432 in pterygium, an ocular disease characterized by a wedge lesion.
Fabienne Wagner et al.
PloS one, 14(10), e0218303-e0218303 (2019-10-24)
Cristae architecture is important for the function of mitochondria, the organelles that play the central role in many cellular processes. The mitochondrial contact site and cristae organizing system (MICOS) together with the sorting and assembly machinery (SAM) forms the mitochondrial

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico