Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU130111

Sigma-Aldrich

MISSION® esiRNA

targeting human CTCF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGACATGGCCTTTGTGACCAGTGGAGAATTGGTTCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTCAAGTGTTCCATGTGCGATTACGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGAGAGCGTCCGTTTCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCACATGA

Ensembl | human accession no.

ENSG00000102974

NCBI accession no.

NM_006565

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTCF(10664) , CTCF(10664)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nathan A Damaschke et al.
Clinical epigenetics, 12(1), 80-80 (2020-06-07)
The chromatin insulator CCCTC-binding factor (CTCF) displays tissue-specific DNA binding sites that regulate transcription and chromatin organization. Despite evidence linking CTCF to the protection of epigenetic states through barrier insulation, the impact of CTCF loss on genome-wide DNA methylation sites
Zhengfei Shan et al.
Journal of cellular and molecular medicine, 23(5), 3130-3139 (2019-03-16)
The present research focuses on the influence of CCCTC-binding factor (CTCF) on prostate cancer (PC) via the regulation of the FoxO signalling pathway. A bioinformatics analysis was conducted to screen out target genes for CTCF in LNCaP cells and to
Lena N Lupey-Green et al.
Virology, 507, 220-230 (2017-04-30)
The Epstein Barr virus (EBV) genome persists in infected host cells as a chromatinized episome and is subject to chromatin-mediated regulation. Binding of the host insulator protein CTCF to the EBV genome has an established role in maintaining viral latency
Li Sun et al.
Theranostics, 10(26), 11950-11962 (2020-11-19)
Rationale: Mesenchymal stem cells (MSCs) have been the focus of many studies because of their abilities to modulate immune responses, angiogenesis, and promote tumor growth and metastasis. Our previous work showed that gastric cancer MSCs (GCMSCs) promoted immune escape by
Francisco Puerta Martínez et al.
Journal of virology, 88(13), 7389-7401 (2014-04-18)
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico