Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU091111

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2K

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGAGGCATAGAGAGCTGCTGATATAGTCAAGCTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATAGATTTCTTTTAAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eun Il Jeong et al.
Cell death & disease, 7(12), e2573-e2573 (2016-12-30)
Cerebral ischemia/reperfusion (I/R) causes brain damage accompanied by ubiquitin accumulation and impairment of proteasome activity. In this study, we report that E2-25K, an E2-conjugating enzyme, is SUMOylated during oxidative stress and regulates cerebral I/R-induced damage. Knockdown of E2-25K expression protects
Wen-Bin Gu et al.
Developmental and comparative immunology, 101, 103452-103452 (2019-07-19)
NFIL3 is a transcriptional activator of the IL-3 promoter in T cells. In vertebrates, it has been characterized as an essential regulator of several cellular processes such as immunity response, apoptosis and NK cells maturation. However, the identification and functional
Lisa Schmölz et al.
Biochimica et biophysica acta, 1863(8), 919-927 (2018-05-08)
The long-chain metabolites of vitamin E (LCM) emerge as a new class of regulatory metabolites and have been considered as the active compounds formed during vitamin E metabolism. The bioactivity of the LCM is comparable to the already established role

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico