Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU062491

Sigma-Aldrich

MISSION® esiRNA

targeting human FYN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTACACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAA

Ensembl | human accession no.

ENSG00000010810

NCBI accession no.

NM_153048

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FYN(2534) , FYN(2534)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jing Zheng et al.
Cancer biotherapy & radiopharmaceuticals, 32(9), 320-326 (2017-11-16)
Tyrosine kinase FYN-a member of the SRC family of kinases-is associated with mediating mitogenic signals and regulating cell cycle entry, growth, and proliferation. It was hypothesized that FYN is upregulated in thyroid carcinoma, which plays a critical role in tumorigenesis.
Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Nikhil Panicker et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(27), 10058-10077 (2015-07-15)
Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present
Hadas Grossman et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(8), 3206-3216 (2015-04-30)
Granulosa cells support the developing oocytes and serve as transducers of the ovulatory stimulus induced by LH surge. Fyn kinase is expressed in granulosa cells, though its role in these cells has not been studied. In human embryonic kidney 293T

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico