Saltar al contenido
Merck

EHU008731

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCAGAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTACCTTTCTAAGACCTCCTCCCAAGCACTTCAAAGGAACTGGAATGATAATGGAAACTGTCAAGAGGGGGCAAGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Soo Min Kim et al.
Molecules and cells, 43(6), 551-571 (2020-06-12)
Nuclear receptor-related 1 (Nurr1) protein has been identified as an obligatory transcription factor in midbrain dopaminergic neurogenesis, but the global set of human NURR1 target genes remains unexplored. Here, we identified direct gene targets of NURR1 by analyzing genome-wide differential
Shawn Llopis et al.
BMC cancer, 13, 139-139 (2013-03-23)
NR4A orphan nuclear receptors are involved in multiple biological processes which are important in tumorigenesis such as cell proliferation, apoptosis, differentiation, and glucose utilization. The significance of NR4A family member NURR1 (NR4A2) in breast cancer etiology has not been elucidated.
Xin Heng et al.
Molecular neurodegeneration, 7, 4-4 (2012-02-03)
NURR1 (also named as NR4A2) is a member of the steroid/thyroid hormone receptor family, which can bind to DNA and modulate expression of target genes. Previous studies have shown that NURR1 is essential for the nigral dopaminergic neuron phenotype and
Hiroki Shimada et al.
FEBS open bio, 7(9), 1410-1421 (2017-09-15)
Aldosterone synthase is the key rate-limiting enzyme in adrenal aldosterone production, and induction of its gene (
S Loppi et al.
Brain, behavior, and immunity, 73, 670-681 (2018-08-01)
Ischemic stroke is amongst the leading causes of death and disabilities. The available treatments are suitable for only a fraction of patients and thus novel therapies are urgently needed. Blockage of one of the cerebral arteries leads to massive and

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico