Skip to Content
Merck
All Photos(1)

Key Documents

EHU097271

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM7

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG

Ensembl | human accession no.

ENSG00000166508

NCBI accession no.

NM_005916

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MCM7(4176) , MCM7(4176)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenjie Li et al.
Molecular medicine reports, 14(6), 5334-5342 (2016-10-26)
Simvastatin (SIM), a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, has been reported to inhibit the activity of hepatitis B virus (HBV), however, the mechanism underlying its antiviral function remains unknown. Minichromosome maintenance (MCM) 7, a component of the MCM complex, has been reported to
E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Xu Zhang et al.
Oncology reports, 33(5), 2599-2605 (2015-03-05)
Human non-small cell lung carcinoma (NSCLC) is one of the most common cancer worldwide. In previous studies, lovastatin, acting as an inhibitor of 3-hydroxy-3-methylglutaryl Co A (HMG-CoA) reductase, exhibited significant antitumor activity during tumorigenesis. However, whether or not this effect

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service