Skip to Content
Merck
All Photos(1)

Documents

EHU085781

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTTGCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCTTCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCAGACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCATCACCTCTGCTTTCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

ATG5 (autophagy protein 5) is involved in the formation of autophagosomes. It is part of the E3-like ATG12-ATG5-ATG16 complex, which is involved with autophagic vesicle formation and expansion. ATG5 is also needed for antigen presentation and thereby enhances viral clearance. Mutation in this gene decreases autophagy, thereby causing ataxia with developmental delay. The ATG5 gene is upregulated in systemic lupus erythematosus. It is also associated with Behçet′s disease. Polymorphisms in this gene are linked with neutrophilic airway inflammation, particularly in adult asthma.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Association of autophagy related gene polymorphisms with neutrophilic airway inflammation in adult asthma.
Pham DL
The Korean Journal of Internal Medicine, 31, 375-375 (2016)
Detecting Genetic Associations between ATG5 and Lupus Nephritis by trans-eQTL.
Zhang YM
Journal of immunology research, 2015, 153132-153132 (2015)
Yiming Shao et al.
Scientific reports, 7(1), 9399-9399 (2017-08-26)
Previous studies demonstrated significant roles of autophagy in the pathogenesis of sepsis, but few studies focused on the effect of autophagy-related SNPs on sepsis susceptibility. In this present study, five polymorphisms of ATG5/ATG16L1 were investigated for the possible risk on
Association of ATG5 Gene Polymorphisms With Behcet's Disease and ATG10 Gene Polymorphisms With VKH Syndrome in a Chinese Han Population.
Zheng M
Investigative Ophthalmology & Visual Science, 56, 8280-8280 (2015)
Mutation in ATG5 reduces autophagy and leads to ataxia with developmental delay.
Kim M
eLife, 5, e12245-e12245 (2016)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service