Skip to Content
Merck
All Photos(1)

Key Documents

EHU096311

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenchao Ji et al.
Biochemical and biophysical research communications, 522(1), 121-126 (2019-11-23)
Lung cancer is the leading cause of cancer death worldwide. PARP inhibitors have become a new line of cancer therapy and a successful demonstration of the synthetic lethality concept. The mechanism and efficacy of PARP inhibitors have been well studied
Eliana Mc Tacconi et al.
EMBO molecular medicine, 9(10), 1398-1414 (2017-07-22)
Maintenance of genome integrity requires the functional interplay between Fanconi anemia (FA) and homologous recombination (HR) repair pathways. Endogenous acetaldehyde, a product of cellular metabolism, is a potent source of DNA damage, particularly toxic to cells and mice lacking the
Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Rikke D Rasmussen et al.
Nature communications, 7, 13398-13398 (2016-11-16)
Oncogene-evoked replication stress (RS) fuels genomic instability in diverse cancer types. Here we report that BRCA1, traditionally regarded a tumour suppressor, plays an unexpected tumour-promoting role in glioblastoma (GBM), safeguarding a protective response to supraphysiological RS levels. Higher BRCA1 positivity
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service