Skip to Content
Merck
All Photos(1)

Key Documents

EHU001761

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRC8A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACATTGTGTACCGCCTCTACATGCGGCAGACCATCATCAAGGTGATCAAGTTCATCCTCATCATCTGCTACACCGTCTACTACGTGCACAACATCAAGTTCGACGTGGACTGCACCGTGGACATTGAGAGCCTGACGGGCTACCGCACCTACCGCTGTGCCCACCCCCTGGCCACACTCTTCAAGATCCTGGCGTCCTTCTACATCAGCCTAGTCATCTTCTACGGCCTCATCTGCATGTATACACTGTGGTGGATGCTACGGCGCTCCCTCAAGAAGTACTCGTTTGAGTCGATCCGTGAGGAGAGCAGCTACAGCGACATCCCCGACGTCAAGAACGACTTCGCCTTCATGCTGCACCTCATTGACCAATACGACCCGCTCTACTCCAAGCGCTTCGCCGTCTTCCTGTCGGAGGTGAGTGAGAACAAGCTGCGGCAGCTGAACCTCAACAACGAGTGGACGCTGGACAAGCTCCGGCAGCGGCTCACCAAGAACGCGCAGGACAAGCTGGAGCTGCACCTGTTCATGCTCAGTGGCATCCCTGACACTGTGTTTGACCTGGTGGAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chao Yang et al.
Human cell, 32(1), 41-50 (2018-11-15)
Chloride (Cl-), a primary anion in the extracellular fluid, plays an important role in a variety of physiological and pathological processes, such as cell apoptosis and proliferation. However, the information about Cl- in cancer cell apoptosis and chemoresistance is poorly
Tomoki Konishi et al.
The American journal of pathology, 189(10), 1973-1985 (2019-07-20)
The volume-regulated anion channel is composed of leucine-rich repeat-containing protein A (LRRC8A) and is activated by hypotonic conditions to implement the process of regulatory volume decrease. The role of LRRC8A in regulating genes related to progression of esophageal squamous cell
Atsushi Shiozaki et al.
International journal of oncology, 55(4), 905-914 (2019-08-23)
Although peritoneal lavage with distilled water performed after surgery prevents peritoneal seeding, cancer cells may avoid rupture under mild hypotonicity through regulatory volume decrease (RVD), which is the homeostatic regulation of ion and water transport. The aim of the present study
Unnur Arna Thorsteinsdottir et al.
Phytotherapy research : PTR, 30(1), 97-104 (2015-11-10)
We have tested the effect of protolichesterinic acid (PA) on the activity of the volume-sensitive release pathway for the organic osmolyte taurine (VSOAC) and the expression of the leucine-rich-repeat-channel 8A (LRRC8A) protein, which constitutes an essential VSOAC component. Exposing human
Andrea Milenkovic et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(20), E2630-E2639 (2015-05-06)
In response to cell swelling, volume-regulated anion channels (VRACs) participate in a process known as regulatory volume decrease (RVD). Only recently, first insight into the molecular identity of mammalian VRACs was obtained by the discovery of the leucine-rich repeats containing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service