HMI0903
MISSION® microRNA Mimic
hsa-miR-675
Synonym(s):
hsa-miR-675-5p
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
product line
MISSION®
form
solid
mature sequence
UGGUGCGGAGAGGGCCCACAGUG
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
human ... hsa-miR-675(100126270)
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Biochem/physiol Actions
The microRNA hsa-miR-675 (also referred to as hsa-miR-675-5p) is present in H19, a long non coding RNA.[1] It is mainly involved in carcinogenesis. This miRNA is downregulated in non-small cell lung cancer (NSCLC) and is associated with tumor progression and development. It works as a tumor suppressor in NSCLC by targeting GPR55 (G-protein coupled receptor 55).[2] The hsa-miR-675 is upregulated in colon cancer and helps in hypoxia-mediated epithelial to mesenchymal transition.[3] It targets ZEB1 (zinc finger E-box-binding homeobox 1) at the post-transcriptional level and controls the progression of pancreatic cancer cells.[4] It also has an oncogenic role in esophageal squamous cell carcinoma by targeting REPS2 (RalBP1-associated Eps domain-containing protein 2).[5]
Other Notes
miRBase V18 Mature ID update: hsa-miR-675-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
13 - Non Combustible Solids
wgk_germany
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
The mir-675-5p regulates the progression and development of pancreatic cancer via the UBQLN1-ZEB1-mir200 axis.
Wang J
Oncotarget, 8, 24978-24987 (2017)
Down-regulation of miR-675-5p contributes to tumor progression and development by targeting pro-tumorigenic GPR55 in non-small cell lung cancer.
He D
Molecular Cancer, 14 (2015)
H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b.
Vennin C
Oncotarget, 6, 29209-29223 (2015)
MiR-675-5p supports hypoxia induced epithelial to mesenchymal transition in colon cancer cells.
Costa V
Oncotarget, 8, 24292-24302 (2017)
miR-675-5p enhances tumorigenesis and metastasis of esophageal squamous cell carcinoma by targeting REPS2.
Zhou YW
Oncotarget, 7, 30730-30747 (2016)
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
