Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

HMI0254

Sigma-Aldrich

MISSION® microRNA Mimic

hsa-miR-155

Synonym(s):

hsa-miR-155-5p

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352200
NACRES:
NA.51

product line

MISSION®

form

solid

mature sequence

UUAAUGCUAAUCGUGAUAGGGGU

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

Gene Information

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Biochem/physiol Actions

The miRNA hsa-miR-155-5p is a hypoxia-inducible oncomir which particularly targets the 3′UTR of the HIF1α (hypoxia-inducible factor 1-α) mRNA. It also targets pVHL (von Hippel Lindau tumour suppressor protein), thereby controlling hypoxic response pathways. The miRNA hsa-miR-155-5p controls ELK3 (ETS domain-containing protein) expression under hypoxia.[1] It also regulates the expression of TFAM (transcription factor A, mitochondrial) and thereby regulates mitochondrial biogenesis in diploid cells.[2] The miRNA hsa-miR-155-5p is upregulated in active MS (multiple sclerosis) lesions.[3]

Other Notes

miRBase V18 Mature ID update: hsa-miR-155-5p

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

11 - Combustible Solids

wgk_germany

WGK 3

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

The oncogenic MicroRNA Hsa-miR-155-5p targets the transcription factor ELK3 and links it to the hypoxia response.
Robertson ED
PLoS ONE, 9, e113050-e113050 (2014)
Integration of MicroRNA databases to study MicroRNAs associated with multiple sclerosis.
Angerstein C
Molecular Neurobiology, 45, 520-520 (2012)
Yujia Shi et al.
Allergy, asthma & immunology research, 10(3), 260-267 (2018-04-21)
Molecular mechanisms leading to asthma is still ill-defined. Though the function of microRNAs (miRNAs) in asthma was previously reported, the involvement of miR-155 in important features of this disease remains unknown. The present study was designed to uncover the probable
Xiang Song et al.
Acta biochimica et biophysica Sinica, 51(4), 386-392 (2019-03-07)
LncRNA NEF has been proved to be a tumor suppressor in liver cancer. In the present study, we found that lncRNA NEF was downregulated and miRNA-155 was upregulated in plasma of triple-negative breast cancer (TNBC) patients compared with those in
Adolfo Quiñones-Lombraña et al.
Biochimica et biophysica acta, 1852(7), 1420-1427 (2015-04-15)
The regulation of mitochondrial biogenesis is under the control of nuclear genes including the master Mitochondrial Transcription Factor A (TFAM). Recent evidence suggests that the expression of TFAM is regulated by microRNAs (miRNAs) in various cellular contexts. Here, we show

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service