Skip to Content
MilliporeSigma
All Photos(1)

Documents

HLTUD2167

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Human

hsa-miR-6125

Synonym(s):

Tough Decoy, TuD

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41106609
NACRES:
NA.51

product line

MISSION®

concentration

≥1x106 VP/ml (via p24 assay)

technique(s)

capture ELISA: 106 TU/mL using p24 (Volume 200 uL)

mature sequence

GCGGAAGGCGGAGCGGCGGA

Sanger mature/minor accession no.

Sanger microRNA accession no.

shipped in

dry ice

storage temp.

−70°C

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Other Notes

Based on miRBase V19 Mature ID

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service