Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU183631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mki67

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACTTCAGAGACACAGGCAAGAAGAAGACTCAGGAGACTGGTTGTTACTGAAGAGCCCATACCACAAAGAAAGACTACAAGAGTTGTAAGGCAAACCAGAAACACACAGAAAGAGCCCATAAGTGACAATCAAGGTATGGAAGAGTTTAAGGAATCTTCAGTACAGAAACAAGACCCAAGTGTAAGTTTAACTGGCAGGAGGAACCAACCAAGGACAGTTAAGGAGAAAACCCAACCCTTAGAAGAACTCACCAGTTTCCAAGAGGAAACTGCCAAAAGAATATCTTCCAAATCTCCACAACCGGAAGAGAAGGAAACCTTAGCAGGTTTAAAGAGGCAGCTCAGAATACAACTAATCAACGATGGTGTAAAAGAAGAGCCCACAGCACAGAGAAAGCAACCATCCAGGGAAACCAGGAACACACTCAAAGAGCCTGTAGGTGACAGTATAAATGTTGAAGAGGTTAAGAAGTCTACAAAGCAGAAAATTGATCCAGTAGCAAGTGTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xu Zhou et al.
Scientific reports, 5, 10071-10071 (2015-05-12)
Cancer neovascularization plays an essential role in the metastasis of larynx carcinoma (LC). However, the underlying molecular mechanisms are not completely understood. Recently, we reported that placental growth factor (PLGF) regulates expression of matrix metalloproteinase 3 (MMP3) through ERK/MAPK signaling
Kanako Tamura et al.
PloS one, 10(5), e0126003-e0126003 (2015-05-06)
Glucagon-like peptide-1 (GLP-1) receptor agonists potentiate glucose-induced insulin secretion. In addition, they have been reported to increase pancreatic beta cell mass in diabetic rodents. However, the precise mode of action of GLP-1 receptor agonists still needs to be elucidated. Here
David W Chapman et al.
EJNMMI research, 4(1), 27-27 (2015-06-28)
The multitargeting tyrosine kinase inhibitor (TKI) sunitinib is currently the first-line drug therapy for metastasizing renal cell carcinoma (RCC). TKIs have profound effects on tumor angiogenesis, leading to modifications of the tumor microenvironment. The goal of this study was to

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service