Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU054211

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCGCGTGGATAAGGAGTTCTCTGGTGTGCCCTGGAACTCACACGACATCTTCCAGTACCAAGACAAAGCCTATTTCTGCCATGGCAAATTCTTCTGGCGTGTGAGTTTCCAAAATGAGGTGAACAAGGTGGACCATGAGGTGAACCAGGTGGACGACGTGGGCTACGTGACCTACGACCTCCTGCAGTGCCCTTGAACTAGGGCTCCTTCTTTGCTTCAACCGTGCAGTGCAAGTCTCTAGAGACCACCACCACCACCACCACACACAAACCCCATCCGAGGGAAAGGTGCTAGCTGGCCAGGTACAGACTGGTGATCTCTTCTAGAGACTGGGAAGGAGTGGAGGCAGGCAGGGCTCTCTCTGCCCACCGTCCTTTCTTGTTGGACTGTTTCTAATAAACACGGATCCCCAACCTTTTCCAGCTACTTTAGTCAATCAGCTTATCTGTAGTTGCAGATGCATCCGAG

Ensembl | mouse accession no.

ENSMUSG00000017737

NCBI accession no.

NM_013599

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MMP9(17395) , Mmp9(17395)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shan Lu et al.
Journal of cellular physiology, 230(8), 1862-1870 (2014-12-30)
MicroRNA-520c (miR-520c) and microRNA-373 (miR-373) are originally characterized as both oncogenes and tumor suppressors in different types of human cancers. In this study, we found that translation of mRNA of MT1-MMP, an oncogene related to tumor metastasis, was well inhibited
Pauli Puolakkainen et al.
Medical oncology (Northwood, London, England), 31(3), 884-884 (2014-02-15)
Patients with chronic pancreatitis with local inflammation have high risk for pancreatic cancer. The aim of this study was to examine the role of the inflammatory cells in the invasion of pancreatic cancer cells, focusing on the involvement of a
Ming-Ju Hsieh et al.
British journal of pharmacology, 171(12), 3037-3050 (2014-03-20)
High mortality and morbidity rates for hepatocellular carcinoma in Taiwan primarily result from uncontrolled tumour metastasis. Glabridin, a prenylated isoflavonoid of licorice (Glycyrrhiza glabra) roots, is associated with a wide range of biological properties, such as regulation of energy metabolism, oestrogenic
Yang Yu et al.
Biochemical and biophysical research communications, 463(3), 285-291 (2015-05-25)
Preeclampsia is a devastating pregnancy-related syndrome characterized by the onset of hypertension, proteinuria and edema. Insufficient invasion of trophoblasts is well-known to be correlated with preeclampsia development. The present study was performed to investigate the functional role microRNA (miRNA)-204 in
Hongmei Yu et al.
Experimental cell research, 333(1), 127-135 (2015-02-24)
Mucus hypersecretion is the key manifestation in patients with chronic inflammatory airway diseases and mucin 5AC (MUC5AC) is a major component of airway mucus. Matrix metalloproteinases (MMP)-9, have been found to be involved in the pathogenesis of inflammatory airway diseases.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service