Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU046811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atox1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGCCGCGTCAGTCATGCCGAAGCACGAGTTCTCCGTGGACATGACCTGTGAGGGCTGTGCTGAAGCCGTCTCCAGAGTCCTCAACAAGCTGGGAGGAGTGGAGTTCAACATTGACCTGCCCAACAAGAAGGTCTGCATCGACTCTGAGCACAGCTCAGACACCCTGCTGGCAACCCTCAACAAAACAGGAAAGGCTGTTTCCTACCTTGGCCCCAAGTAGCCAGGACCTGGGCGAGTCCTTCCGGATATAAACTGAAGAGGCAGGCTGTTGATCTGGTCTCCCCGGCAGATCTGGAACACCAACTGCTCAGTCCAGTCCAGCCCAGCCATGGAGTTCCTGCCCAGACAGGCCTTCCCCGCTGGCTCCCTGCAAGCTTCCATGTAATAAAGTCAAGCTGAGTTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Arundhati Jana et al.
PloS one, 15(1), e0227916-e0227916 (2020-01-22)
Colorectal cancer remains a deadly cancer due to metastatic disease. To understand the molecular mechanisms of metastasis in colon cancer, we investigated whether the copper chaperone antioxidant-1 (Atox1) protein plays a role in this process. Recent findings indicate that Atox1
Gin-Fu Chen et al.
Scientific reports, 5, 14780-14780 (2015-10-07)
Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and
Huawei Cai et al.
Oncology reports, 30(1), 269-275 (2013-04-30)
Copper is required for cell proliferation and tumor angiogenesis. Cellular copper metabolism is regulated by a network of copper transporters and chaperones. Antioxidant-1 (ATOX1) is a cytosolic copper chaperone important for intracellular copper transport, which plays a role in the
Edward A Ratovitski
Current pharmaceutical biotechnology, 16(9), 832-850 (2015-06-20)
MicroRNAs, whose transcription is regulated by members of the tumor protein p53 family, modulate the expression of numerous metabolic enzymes, significantly altering tumor cell response to chemotherapeutic treatments. The role for ΔNp63α-regulated microRNAs in regulation of cell cycle arrest, apoptosis

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service