Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU036901

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Scarb1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAATTTGGCCTGTTTGTTGGGATGAACAACTCGAATTCTGGGGTCTTCACTGTCTTCACGGGCGTCCAGAATTTCAGCAGGATCCATCTGGTGGACAAATGGAACGGACTCAGCAAGATCGATTATTGGCATTCAGAGCAGTGTAACATGATCAATGGGACTTCCGGGCAGATGTGGGCACCCTTCATGACACCCGAATCCTCGCTGGAATTCTTCAGCCCGGAGGCATGCAGGTCCATGAAGCTGACCTACAACGAATCAAGGGTGTTTGAAGGCATTCCCACGTATCGCTTCACGGCCCCCGATACTCTGTTTGCCAACGGGTCCGTCTACCCACCCAACGAAGGCTTCTGCCCATGCCGAGAGTCTGGCATTCAGAATGTCAGCACCTGCAGGTTTGGTGCGCCTCTGTTTCTCTCCCACCCCCACTTTTACAACGCCGACCCTGTGTTGTCAGAAGCTGTTCTTGGTCTGAACCCTAACCCAAAGGAGC

Ensembl | mouse accession no.

ENSMUSG00000037936

NCBI accession no.

NM_016741

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SCARB1(20778) , Scarb1(20778)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Laeticia Lichtenstein et al.
Cardiovascular research, 106(2), 314-323 (2015-03-15)
High-density lipoproteins (HDLs) protect against atherosclerosis mainly due to their function in hepatobiliary reverse cholesterol transport (RCT). This is a process whereby excess cholesterol from peripheral tissues is transported by HDL particles to the liver for further metabolism and biliary
Georgia Schäfer et al.
PloS one, 4(12), e8448-e8448 (2009-12-31)
The interaction between Mycobacterium tuberculosis (Mtb) and host cells is complex and far from being understood. The role of the different receptor(s) implicated in the recognition of Mtb in particular remains poorly defined, and those that have been found to
Pin Yue et al.
PloS one, 5(3), e9906-e9906 (2010-04-03)
CD36 facilitates oxidized low density lipoprotein uptake and is implicated in development of atherosclerotic lesions. CD36 also binds unmodified high and very low density lipoproteins (HDL, VLDL) but its role in the metabolism of these particles is unclear. Several polymorphisms
Xia Chu et al.
Molecular nutrition & food research, 59(8), 1491-1503 (2015-05-07)
Ursolic acid (UA) is a triterpenoid compound with multifold biological functions. Our previous studies have reported that UA protects against high-fat diet-induced obesity and improves insulin resistance (IR). However, the potential mechanisms are still undefined. Free fatty acid (FFA) metabolism
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service