Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU227251

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPD

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$377.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$377.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGAGACTCAGCAACGACCCATACCTCAGACCCGACGGCCCGGAGCGGAGCGCGCCCTGCCCTGGCGCAGCCAGAGCCGCCGGGTGCCCGCTGCAGTTTCTTGGGACATAGGAGCGCAAAGAAGCTACAGCCTGGACTTACCACCACTAAACTGCGAGAGAAGCTAAACGTGTTTATTTTCCCTTAAATTATTTTTGTAATGGTAGCTTTTTCTACATCTTACTCCTGTTGATGCAGCTAAGGTACATTTGTAAAAAGAAAAAAAACCAGACTTTTCAGACAAACCCTTTGTATTGTAGATAAGAGGAAAAGACTGAGCATGCTCACTTTTTTATATTAATTTTTACAGTATTTGTAAGAATAAAGCAGCATTTGAAATCGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

David A Knowles et al.
PLoS computational biology, 15(5), e1006743-e1006743 (2019-05-29)
Drug screening studies typically involve assaying the sensitivity of a range of cancer cell lines across an array of anti-cancer therapeutics. Alongside these sensitivity measurements high dimensional molecular characterizations of the cell lines are typically available, including gene expression, copy
Kenjiro Tanaka et al.
British journal of pharmacology, 173(6), 1058-1069 (2016-01-12)
The sympathetic nervous system regulates bone remodelling, in part, through ß2 -adrenoceptor signalling. However, the physiological role of α1 -adrenoceptor signalling in bone in vivo remains unclear. Therefore, to obtain a deeper understanding of bone remodelling by the sympathetic nervous
Leonie Hartl et al.
Cancers, 12(9) (2020-09-11)
CCAAT/enhancer-binding protein δ (C/EBPδ) is a transcription factor involved in growth arrest and differentiation, which has consequently been suggested to harbor tumor suppressive activities. However, C/EBPδ over-expression correlates with poor prognosis in glioblastoma and promotes genomic instability in cervical cancer

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service