Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU158801

Sigma-Aldrich

MISSION® esiRNA

targeting human MYLK (1)

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAGAATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTGCTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTGTCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATCTGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAACGTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTATGGAACCAGTGAGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sho Hiroyasu et al.
Journal of cell science, 130(14), 2329-2343 (2017-06-10)
During healing of the skin, the cytoskeleton of keratinocytes and their matrix adhesions, including focal adhesions (FAs), undergo reorganization. These changes are coordinated by small GTPases and their regulators, including the guanine nucleotide exchange factor β-PIX (also known as ARHGEF7).
Shaoqing Chen et al.
Journal of cellular physiology, 235(11), 7757-7768 (2019-11-20)
Long noncoding RNAs (lncRNAs) play a crucial role in several malignances, involving nasopharyngeal carcinoma (NPC), a heterogeneous disease. This study investigated mechanism of serine/arginine repetitive matrix protein 2-alternative splicing (SRRM2-AS) in NPC cell proliferation, differentiation, and angiogenesis. Initially, differentially expressed
Nityanand Srivastava et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12805-12819 (2020-08-11)
Increased endothelial permeability leads to excessive exudation of plasma proteins and leukocytes in the interstitium, which characterizes several vascular diseases including acute lung injury. The myosin light chain kinase long (MYLK-L) isoform is canonically known to regulate the endothelial permeability
A Martinsen et al.
Pflugers Archiv : European journal of physiology, 466(7), 1377-1389 (2013-10-29)
The Ca(2+)-dependent kinase myosin light chain kinase (MLCK) is the activator of smooth muscle contraction. In addition, it has been reported to be involved in Ca(2+) channel regulation in cultured cells, and we previously showed that the MLCK inhibitor ML-7

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service