Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU157631

Sigma-Aldrich

MISSION® esiRNA

targeting human KIAA1524

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGCAATCATCAAATCACAGTTTTCCAACATCAATAAAGTGTTTAACTCCTCATTTGAAAGATGGTGTTCCTGGATTGAATATTGAAGAATTAATAGAGAAACTTCAGTCTGGAATGGTGGTAAAGGATCAGATTTGTGATGTGAGAATATCTGACATAATGGATGTATATGAAATGAAACTATCCACATTAGCTTCCAAAGAAAGCAGGCTACAAGATCTTTTGGAAACAAAAGCTCTAGCCCTTGCACAGGCTGATAGACTGATTGCTCAGCATCGCTGTCAAAGAACTCAAGCTGAAACAGAGGCACGGACACTTGCTAGTATGTTGAGAGAAGTTGAGAGAAAAAATGAAGAGCTTAGTGTGTTGCTGAAGGCGCAGCAAGTTGAATCAGAAAGAGCGCAGAGTGA

Ensembl | human accession no.

ENSG00000163507

NCBI accession no.

NM_020890

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIAA1524(57650) , KIAA1524(57650)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liliana Cantini et al.
PloS one, 8(9), e73348-e73348 (2013-09-11)
Despite a better understanding of the pathogenesis of oral cancer, its treatment outcome remains poor. Thus, there is a need for new therapeutic strategies to improve the prognosis of this disease. RNA interference (RNAi) appears to be a promising therapeutic
Xu-Dong Chen et al.
Oncology reports, 38(2), 1005-1012 (2017-06-29)
Laryngeal carcinoma is one of the most common malignant tumors in otorhinolaryngology. Moreover, experimental investigation showed that cancerous inhibitor of protein phosphatase 2A (CIP2A) expressed highly in various cancers. Therefore, we investigated whether CIP2A can regulate the proliferation, invasion and
Lisa P Huang et al.
Cancer medicine, 1(1), 76-81 (2013-01-24)
Bladder cancer is one of the most common cancers in the United States. Numerous markers have been evaluated for suitability of bladder cancer detection and surveillance. However, few of them are acceptable as a routine tool. Therefore, there exists a
Yongzhen Zhang et al.
Journal of Cancer, 9(21), 4029-4038 (2018-11-10)
CIP2A is a well-known oncoprotein whose expression is elevated in multiple human solid tumor types. However, its role in renal cell carcinoma (RCC) development is poorly understood. Thus, in our present study, we used the renal cancer cell lines 786-O
Shihua Zhang et al.
OncoTargets and therapy, 13, 4063-4074 (2020-06-05)
Recent evidence showed cancerous inhibitor of protein phosphatase 2A (CIP2A) plays carcinogenesis roles in several types of human cancer. However, the expression and function of CIP2A in gliomas are unknown. qRT-PCR, IHC and Western blot were used to evaluate CIP2A
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service