Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU154181

Sigma-Aldrich

MISSION® esiRNA

targeting human NOL3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGACGAGTCCGAAGATTCCTGAAGGCCAGAGCTCTGACAGGCGGTGCCCCGCCCATGCTGGATAGGACCTGGGATGCTGCTGGAGCTGAATCGGATGCCACCAAGGCTCGGTCCAGCCCAGTACCGCTGGAAGTGAATAAACTCCGGAGGGTCGGACGGGACCTGGGCTCTCTCCACGATTCTGGCTGTTTGCCCAGGAACTTAGGGTGGGTACCTCTGAGTCCCAGGGACCTGGGCAGGCCCAAGCCCACCACGAGCATCATCCAGTCCTCAGCCCTAATCTGCCCTTAGGAGTCCAGGCTGCACCCTGGAGATCCCAAACCTAGCCCCCTAGTGGGACAAGGACCTGACCCTCCTGCCCGCATACACAACCCATTTCCCCTGGTGAGCCACTTGGCAGCATATGTAGGTACCAGCTCAACCCCACGCAAGTTCCTGAGCTGAACATGGAGCAAGGGGAGGGTGACTTCTCTCCACATAGGGAGGGCTTAGAGCTCACAGCCTTGGGAAGTGAGACTAGAAGAGGGGAGCAGAAAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Csaba Toth et al.
Cell communication and signaling : CCS, 15(1), 16-16 (2017-05-04)
Renal cell carcinomas (RCCs) display broad resistance against conventional radio- and chemotherapies, which is due at least in part to impairments in both extrinsic and intrinsic apoptotic pathways. One important anti-apoptotic factor that is strongly overexpressed in RCCs and known
Fang Xie et al.
Acta physiologica (Oxford, England), 228(2), e13337-e13337 (2019-07-02)
Cardiac hypertrophy and myocardial apoptosis are two major factors in heart failure. As a classical regulator of apoptosis, apoptosis repressor with caspase recruitment domain (ARC) has recently also been found to have a protective effect against hypertrophy. However, the mechanism
Christopher DeBoever et al.
Nature communications, 9(1), 1612-1612 (2018-04-25)
Protein-truncating variants can have profound effects on gene function and are critical for clinical genome interpretation and generating therapeutic hypotheses, but their relevance to medical phenotypes has not been systematically assessed. Here, we characterize the effect of 18,228 protein-truncating variants
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service