Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU150481

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF4EBP1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTC

Ensembl | human accession no.

ENSG00000187840

NCBI accession no.

NM_004095

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EIF4EBP1(1978) , EIF4EBP1(1978)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
AEJM
QCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Asiya Batool et al.
Biochemical and biophysical research communications, 527(2), 489-495 (2020-04-28)
Translational regulation has invited considerable interest consequent of its circumstantial dysregulation during cancer genesis. eIF4E (Eukaryotic Initiation Factor 4E) has been identified as an important factor involved in tumor progression by way of instrumenting the convergence of oncogenic signals for
Jin Young Sung et al.
Experimental gerontology, 109, 51-58 (2017-08-12)
Cellular senescence is related to aging and extremely stable proliferative arrest with active metabolism. Senescent cells can activate mammalian target of rapamycin (mTOR) pathway, which plays a crucial role in the regulation of cell metabolism, cellular growth, and autophagy in
Stabilization of 4E-BP1 by PI3K kinase and its involvement in CHK2 phosphorylation in the cellular response to radiation.
Zi-Jian Yu et al.
International journal of medical sciences, 14(5), 452-461 (2017-05-26)
Yunfei Wen et al.
Molecular cancer therapeutics, 19(9), 1943-1954 (2020-08-02)
Abnormal activity of human prolactin (PRL) and its membrane-associated receptor (PRLR) contributes to the progression of uterine carcinoma. However, the underlying mechanisms are not well understood, and current means of targeting the PRL/PRLR axis in uterine cancer are limited. Our
Thomas Graillon et al.
Oncotarget, 8(33), 55361-55373 (2017-09-15)
Pasireotide is a somatostatin analog (SSA) that targets somatostatin receptor subtype 1 (SST1), SST2, SST3, and SST5 with a high affinity. Pasireotide has a better antisecretory effect in acromegaly, Cushing's disease, and neuroendocrine tumors than octreotide. In this study, we
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service