Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU147811

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2S

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me

Get notified when this item is ready to ship via email.

All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAACGTGGAGAACCTACCCCCGCACATCATCCGCCTGGTGTACAAGGAGGTGACGACACTGACCGCAGACCCACCCGATGGCATCAAGGTCTTTCCCAACGAGGAGGACCTCACCGACCTCCAGGTCACCATCGAGGGCCCTGAGGGGACCCCATATGCTGGAGGTCTGTTCCGCATGAAACTCCTGCTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACCAAGATCTTCCACCCGAACGTGGGCGCCAATGGCGAGATCTGCGTCAACGTGCTCAAGAGGGACTGGACGGCTGAGCTGGGCATCCGACACGTACTGCTGACCATCAAGTGCCTGCTGATCCACCCTAACCCCGAGTCTGCACTCAACGAGGAGGCGGGCCGCCTGCTCTTGGAGAACTACGAGGAGTATGCGGCTC

Ensembl | human accession no.

ENSG00000108106

NCBI accession no.

NM_014501

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... UBE2S(27338) , UBE2S(27338)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
XZU
ZYU
QCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peng Kuang et al.
Scientific reports, 6, 37441-37441 (2016-12-03)
SAG/RBX2 and RBX1 are two family members of RING components of Cullin-RING ligases (CRLs), required for their enzymatic activity. Previous studies showed that SAG prefers to bind with CUL5, as well as CUL1, whereas RBX1 binds exclusively to CULs1-4. Detailed
Shusaku Yoshimura et al.
Biochemical and biophysical research communications, 485(4), 820-825 (2017-03-05)
Ubiquitin-conjugating enzyme E2S (UBE2S), a family of E2 protein in the ubiquitin-proteasome system, is highly expressed in several types of cancers; however, its roles in oral squamous cell carcinoma (OSCC) have not yet been well elucidated. The purpose of this
Tsung-Han Lin et al.
Food & function, 8(4), 1558-1568 (2017-03-10)
We previously reported that the dietary flavonoids, luteolin and quercetin, might inhibit the invasiveness of cervical cancer by reversing epithelial-mesenchymal transition (EMT) signaling. However, the regulatory mechanism exerted by luteolin and quercetin is still unclear. This study analyzed the invasiveness
Raquel C Martinez-Chacin et al.
Nature structural & molecular biology, 27(6), 550-560 (2020-05-13)
The interplay between E2 and E3 enzymes regulates the polyubiquitination of substrates in eukaryotes. Among the several RING-domain E3 ligases in humans, many utilize two distinct E2s for polyubiquitination. For example, the cell cycle regulatory E3, human anaphase-promoting complex/cyclosome (APC/C)
Jennifer L Franks et al.
PLoS biology, 18(12), e3000975-e3000975 (2020-12-12)
The anaphase-promoting complex/cyclosome (APC/C) is an E3 ubiquitin ligase and critical regulator of cell cycle progression. Despite its vital role, it has remained challenging to globally map APC/C substrates. By combining orthogonal features of known substrates, we predicted APC/C substrates
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service