Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU146121

Sigma-Aldrich

MISSION® esiRNA

targeting human CXXC5

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATTTCCACCTGGACACCTGACCATGTGCCTGCCCTGAGCAGCGAGGCCCACCAGGCATCTCTGTTGTGGGCAGCAGGGCCAGGTCCTGGTCTGTGGACCCTCGGCAGTTGGCAGGCTCCCTCTGCAGTGGGGTCTGGGCCTCGGCCCCACCATGTCGAGCCTCGGCGGTGGCTCCCAGGATGCCGGCGGCAGTAGCAGCAGCAGCACCAATGGCAGCGGTGGCAGTGGCAGCAGTGGCCCAAAGGCAGGAGCAGCAGACAAGAGTGCAGTGGTGGCTGCCGCCGCACCAGCCTCAGTGGCAGATGACACACCACCCCCCGAGCGTCGGAACAAGAGCGGTATCATCAGTGAGCCCCTCAACAAGAGCCTGCGCCGCTCCCGCCCGCTCTCCCACTACTCTTCTTTTGGCAGCAGTGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhibin Cui et al.
Scientific reports, 7, 40325-40325 (2017-01-10)
Malignant peripheral nerve sheath tumors (MPNSTs) are a type of rare sarcomas with a poor prognosis due to its highly invasive nature and limited treatment options. Currently there is no targeted-cancer therapy for this type of malignancy. Thus, it is
Pelin Yaşar et al.
Scientific reports, 6, 37808-37808 (2016-11-26)
17β-estradiol (E2), the primary circulating estrogen hormone, mediates physiological and pathophysiological functions of breast tissue mainly through estrogen receptor α (ERα). Upon binding to E2, ERα modulates the expression of target genes involved in the regulation of cellular proliferation primarily
Gamze Ayaz et al.
Scientific reports, 10(1), 5971-5971 (2020-04-07)
Evidence suggests that the CXXC type zinc finger (ZF-CXXC) protein 5 (CXXC5) is a critical regulator/integrator of various signaling pathways that include the estrogen (E2)-estrogen receptor α (ERα). Due to its ZF-CXXC domain, CXXC5 is considered to be a member

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service