Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU146001

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX7

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)
All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCGTCCCAAATACAGTTTCCGTCGCCTTGACGACAAGACCACCAACGTGTCCTTGTACCCTGGCTACAACTTCAGATACGCCAAGTACTACAAGGAAAACAATGTTGAGAAACGGACTCTGATAAAAGTCTTCGGGATCCGTTTTGACATCCTGGTTTTTGGCACCGGAGGAAAATTTGACATTATCCAGCTGGTTGTGTACATCGGCTCAACCCTCTCCTACTTCGGTCTGGCCGCTGTGTTCATCGACTTCCTCATCGACACTTACTCCAGTAACTGCTGTCGCTCCCATATTTATCCCTGGTGCAAGTGCTGTCAGCCCTGTGTGGTCAACGAATACTACTACAGGAAGAAGTGCGAGTCCATTGTGGAGCCAAAGCCGACATTAAAGTATGTGTCCTTTGTGGATGAATCCCAC

Ensembl | human accession no.

ENSG00000089041

NCBI accession no.

NM_002562

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... P2RX7(5027) , P2RX7(5027)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
WWU
HOU
QCS
VGT

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Pan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13533-13543 (2016-07-30)
Uveal melanoma (UM) has a high mortality rate for primary intraocular tumors. Approximately half of UM patients present with untreatable and fatal metastases. Long non-coding RNAs (lncRNAs) have emerged as potent regulatory RNAs that play key roles in various cellular
Shu Guan et al.
Frontiers in psychiatry, 10, 770-770 (2019-11-05)
Diabetic neuropathic pain (DNP) and major depressive disorder (MDD) are common complications of diabetes mellitus and mutually affect each other. As a member of the ATP-gated ion channel family, P2X7 receptor is associated with the transduction of pain signal and
Wang Lili et al.
Experimental biology and medicine (Maywood, N.J.), 244(9), 734-742 (2019-05-02)
The mechanism of gastric cancer is highly complex, accompanied by a variety of genetic abnormalities. It is of great significance to elucidate the pathogenesis of gastric cancer, find its markers and therapeutic targets in the fight against this fatal disease.
M Nascimento et al.
Life sciences, 251, 117640-117640 (2020-04-08)
To evaluate the effects of P2X7 receptor blockade on renin-angiotensin system (RAS) in rats with diabetic nephropathy (DN). Wistar rats were unilaterally nephrectomized and received streptozotocin for diabetes mellitus (DM) induction; control animals (CTL) received the drug vehicle. The animals
Valentina Salvestrini et al.
Oncotarget, 8(4), 5895-5908 (2016-12-17)
Recent studies have shown that high ATP levels exhibit direct cytotoxic effects on several cancer cells types. Among the receptors engaged by ATP, P2X7R is the most consistently expressed by tumors. P2X7R is an ATP-gated ion channel that could drive
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service