Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU143531

Sigma-Aldrich

MISSION® esiRNA

targeting human SRGN

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCACCCTGCTACATTTCCTAATCAAGAAGTTGGCGTGCAGCTGGGAGAGCTAGACTAAGTTGGTCATGATGCAGAAGCTACTCAAATGCAGTCGGCTTGTCCTGGCTCTTGCCCTCATCCTGGTTCTGGAATCCTCAGTTCAAGGTTATCCTACGCGGAGAGCCAGGTACCAATGGGTGCGCTGCAATCCAGACAGTAATTCTGCAAACTGCCTTGAAGAAAAAGGACCAATGTTCGAACTACTTCCAGGTGAATCCAACAAGATCCCCCGTCTGAGGACTGACCTTTTTCCAAAGACGAGAATCCAGGACTTGAATCGTATCTTCCCACTTTCTGAGGACTACTCTGGATCAGGCTTCGGCTCCGGCTCCGGCTCTGGATCAGGATCTGGGAGTGGCTTCCTAACGGAAATGGAACAGGATTACCAACTAGTAGACGAAAGTGATGCTTTCCATGACAACCTTAGGTCTCTTGACAGGAATCTGCCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Angela D'Ascola et al.
Biochemical and biophysical research communications, 499(3), 506-512 (2018-03-29)
Serglycin is expressed by a variety of cell types and mediates different functions in both normal and pathological conditions by interacting with different biological molecules, such as the CD44 receptor. Many studies suggest that serglycin has a crucial role in
Qinfeng Ma et al.
Molecular and cellular biochemistry, 474(1-2), 15-26 (2020-07-28)
Endothelial cells (ECs) play an important role in the pathogenesis of cardiovascular disease, especially atherosclerosis (AS). The abnormal wall shear stress (WSS) which directly contacts with ECs is the key stimulating factor leading to AS. However, the underlying mechanism of
Michele Scuruchi et al.
Archives of biochemistry and biophysics, 669, 80-86 (2019-05-31)
Serglycin (SRGN) is an intracellular proteoglycan produced and secreted by several cell types. The increased expression of SRGN was associated with greater aggressiveness in cancer and inflammation. In this study, we demonstrated that SRGN is increased in human chondrocytes after

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service