Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU141651

Sigma-Aldrich

MISSION® esiRNA

targeting human ESR1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shan Gao et al.
Frontiers in oncology, 10, 753-753 (2020-06-06)
Background: Dysregulation of ESR1 accounts for endocrine therapy resistance and metastasis of ERα positive breast cancer. However, the underlying molecular mechanism of ESR1 in ERα positive breast cancer remains insufficiency. Notably, to date, a comprehensive miRNA-mRNA regulatory network involved in
Fang Liu et al.
Molecular diagnosis & therapy, 22(5), 551-569 (2018-06-22)
Small interfering RNAs (siRNAs) are an attractive new agent with potential as a therapeutic tool because of its ability to inhibit specific genes for many conditions, including viral infections and cancers. However, despite this potential, many challenges remain, including off-target
Keivan Mobini et al.
Journal of biochemical and molecular toxicology, e22304-e22304 (2019-02-20)
The underlying functions of miR-206, miR-133a, miR-27b, and miR-21, and their link to the estrogen receptor alpha (ERα) and aryl hydrocarbon receptor (AhR) signaling pathways remain largely unexplored. In this study, we detect the expression of miR-206, miR-133a, miR-27b, and
Sarah R Hosford et al.
Molecular oncology, 13(8), 1778-1794 (2019-06-11)
Estrogens have been shown to elicit anticancer effects against estrogen receptor α (ER)-positive breast cancer. We sought to determine the mechanism underlying the therapeutic response. Response to 17β-estradiol was assessed in ER+ breast cancer models with resistance to estrogen deprivation:
Erik Hilborn et al.
Oncotarget, 8(37), 62183-62194 (2017-10-06)
To investigate the influence of estrogen, androgen, microRNAs, and genes implicated in breast cancer on the expression of HSD17B1 and HSD17B2. Breast cancer cell lines ZR-75-1, MCF7, T47D, SK-BR-3, and the immortalized epithelial cell line MCF10A were used. Cells were

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service