Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU140771

Sigma-Aldrich

MISSION® esiRNA

targeting human ANO1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCCGACGAAGAAGATGTACCACATTAATGAGACCCGTGGCCTCCTGAAAAAAATCAACTCTGTGCTCCAGAAAATCACAGATCCCATCCAGCCCAAAGTGGCTGAGCACAGGCCCCAGACCATGAAGAGACTCTCCTATCCCTTCTCCCGGGAGAAGCAGCATCTATTTGACTTGTCTGATAAGGATTCCTTTTTCGACAGCAAAACCCGGAGCACGATTGTCTATGAGATCTTGAAGAGAACGACGTGTACAAAGGCCAAGTACAGCATGGGCATCACGAGCCTGCTGGCCAATGGTGTGTACGCGGCTGCATACCCACTGCACGATGGAGACTACAACGGTGAAAACGTCGAGTTCAACGACAGAAAACTCCTGTACGAAGAGTGGGCACGCTATGGAGTTTTCTATAAGTACCAGCCCATCGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shenbin Liu et al.
British journal of pharmacology, 173(7), 1208-1218 (2016-01-13)
TMEM16A, also known as anoctamin 1 channel, is a member of the Ca(2+)-activated chloride channels family and serves as a heat sensor in the primary nociceptors. Eact is a recently discovered small molecule activator of the TMEM16A channel. Here, we
Huan Lian et al.
Biochemical and biophysical research communications, 487(2), 201-208 (2017-04-11)
Diabetic nephropathy (DN) is one of the most common microvascular complication of diabetes mellitus (DM) as well as the main reason resulting in chronic renal failure. Transmembrane protein 16A (TMEM16A) plays an important role in multiple physiological actions. Here we
Hui Wang et al.
Cancer letters, 455, 48-59 (2019-05-03)
The Ca2+-activated chloride channel TMEM16A (anoctamin 1) is overexpressed in breast cancer. It remains unclear how TMEM16A overexpression plays a role in carcinogenesis in breast cancer. In this study, we found that high TMEM16A expression in combination with high EGFR
Fang Liu et al.
Oncotarget, 6(13), 11585-11599 (2015-04-04)
TMEM16A is a newly identified calcium activated chloride channel, and has been reported to be overexpressed by various solid malignant cancers to promote proliferation and invasion, yet little is known about its role in gastric cancer(GC). Therefore, we investigated the
Chuantao Zhang et al.
International journal of clinical oncology, 25(6), 1145-1154 (2020-04-03)
Increase of the Ca2+-activated chloride channel TMEM16A is contribute to tumorigenesis. However, the expression level of TMEM16A and its underlying molecular mechanism for TMEM16Apromotingliver carcinogenesis is remains unknown. In the present study, the expression of TMEM16A in hepatocellular carcinoma (HCC)

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service