Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU138031

Sigma-Aldrich

MISSION® esiRNA

targeting human ICAM1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGAACCTATCCCGGGACAGGGCCTCTTCCTCGGCCTTCCCATATTGGTGGCAGTGGTGCCACACTGAACAGAGTGGAAGACATATGCCATGCAGCTACACCTACCGGCCCTGGGACGCCGGAGGACAGGGCATTGTCCTCAGTCAGATACAACAGCATTTGGGGCCATGGTACCTGCACACCTAAAACACTAGGCCACGCATCTGATCTGTAGTCACATGACTAAGCCAAGAGGAAGGAGCAAGACTCAAGACATGATTGATGGATGTTAAAGTCTAGCCTGATGAGAGGGGAAGTGGTGGGGGAGACATAGCCCCACCATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Gu et al.
Oncotarget, 8(67), 111882-111901 (2018-01-18)
Intercellular adhesion molecule-1 is the adhesion molecule mediating leukocyte firm adhesion to endothelial cells, plays a critical role in subsequent leukocyte transmigration. ICAM-1 is also expressed in other cells including macrophages; however, the role of this adhesion molecule in mediating
Haifeng Ma et al.
Journal of cardiovascular pharmacology, 76(5), 617-626 (2020-11-10)
Emerging evidence has demonstrated that long noncoding RNAs are related to the pathogenesis of atherosclerosis. We aimed to investigate the roles and molecular mechanisms of myocardial infarction-associated transcript (MIAT) in the proliferation, migration, and invasion of oxidized low-density lipoprotein (ox-LDL)-induced
Pei-Yue Jiang et al.
American journal of translational research, 11(9), 6249-6261 (2019-10-22)
We aimed to investigate the value of cholestasis-related miRNAs in the diagnosis of intra-hepatic cholestasis of pregnancy (ICP) as well as the molecular mechanisms underlying the role of these miRNAs in the pathogenesis of ICP. In this study, electron microscopy
Sheng-Wei Lai et al.
Nutrients, 11(6) (2019-06-19)
Natural products have historically been regarded as an important resource of therapeutic agents. Resveratrol and melatonin have been shown to increase SIRT1 activity and stimulate deacetylation. Glioblastoma multiforme (GBM) is the deadliest of malignant types of tumor in the central
Hannah L Wiesolek et al.
The American journal of pathology, 190(4), 874-885 (2020-02-09)
Intercellular adhesion molecule-1 (ICAM-1) is up-regulated during inflammation by several cell types. ICAM-1 is best known for its role in mediating leukocyte adhesion to endothelial cells and guiding leukocytes across the vascular wall. Recently, macrophages have been shown to express

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service