Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU134341

Sigma-Aldrich

MISSION® esiRNA

targeting human RPN2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCACTGAAGTTGGCATCACAAATGTTGATCTTTCCACCGTGGATAAGGATCAGAGCATTGCACCCAAAACTACCCGGGTGACATACCCAGCCAAAGCCAAGGGCACATTCATCGCAGACAGCCACCAGAACTTCGCCTTGTTCTTCCAGCTGGTAGATGTGAACACTGGTGCTGAACTCACTCCTCACCAGACATTTGTCCGACTCCATAACCAGAAGACTGGCCAGGAAGTGGTGTTTGTTGCCGAGCCAGACAACAAGAACGTGTACAAGTTTGAACTGGATACCTCTGAAAGAAAGATTGAATTTGACTCTGCCTCTGGCACCTACACTCTCTACTTAATCATTGGAGATGCCACTTTGAAGAACCCAATCCTCTGGAATGTGGCTGATGTGGTCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinhai Ren et al.
Experimental biology and medicine (Maywood, N.J.), 245(12), 1009-1015 (2020-05-26)
This study explored the role of ribophorin II (RPN2) in myelodysplastic syndromes (MDSs) cell proliferation and growth and revealed that RPN2 knockdown suppressed OCI-AML3 cell growth and proliferation and triggered cell cycle arrest and elicited apoptosis in OCI-AML3 cells. In
Jikui Sun et al.
Cell death & disease, 11(10), 890-890 (2020-10-23)
Accumulating evidence indicates that the dysregulation of the miRNAs/mRNA-mediated carcinogenic signaling pathway network is intimately involved in glioma initiation and progression. In the present study, by performing experiments and bioinformatics analysis, we found that RPN2 was markedly elevated in glioma
Gabriela Vazquez Rodriguez et al.
Frontiers in oncology, 10, 598684-598684 (2020-12-18)
The majority of estrogen receptor positive (ER+) breast cancer (BC) maintain the ER at metastatic sites. Despite anti-estrogen therapy, almost 30% of ER+ BC patients relapse. Thus, new therapeutic targets for ER+ BC are needed. Amino acids (AAs) may affect

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service