Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU130891

Sigma-Aldrich

MISSION® esiRNA

targeting human TUG1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA

Ensembl | human accession no.

ENSG00000182457

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TUG1(55000)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jingjing Li et al.
Oncotarget, 8(39), 65932-65945 (2017-10-17)
Emerging evidence shows that the Hedgehog pathway and the long noncoding RNA TUG1 play pivotal roles in cell proliferation, migration, and invasion in tumors. However, the mechanism underlying the effect of TUG1 and the Hedgehog pathway in hepatoma remains undefined.
E Zhang et al.
Cell death & disease, 7, e2109-e2109 (2016-02-26)
Recent evidence highlights long noncoding RNAs (lncRNAs) as crucial regulators of cancer biology that contribute to tumorigenesis. LncRNA TUG1 was initially detected in a genomic screen for genes upregulated in response to taurine treatment in developing mouse retinal cells. Our
Zhi-Qiang Li et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 46(10), 956-960 (2017-06-10)
This study sought to study the expression of the long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) in tongue squamous cell carcinoma (TSCC) and reveal its possible function. qRT-PCR was used to evaluate 27 samples of fresh TSCC tissues and
Huijuan Jiang et al.
Radiation oncology (London, England), 12(1), 65-65 (2017-04-06)
Long non-coding RNAs (lncRNAs) have been reported to regulate the sensitivity of different cancer cells to chemoradiotherapy. Aberrant expression of lncRNA Taurine-upregulated gene 1 (TUG1) has been found to be involved in the development of bladder cancer, however, its function
Yanqian Wang et al.
International journal of oncology, 54(4), 1317-1326 (2019-02-06)
Melanoma is an aggressive type of skin cancer, characterized by high mortality rates worldwide. Therefore, the identification of new diagnostic markers and therapeutic targets for melanoma is imperative. Accumulating evidence has demonstrated that long non-coding RNAs (lncRNAs) play important roles
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service