Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU129801

Sigma-Aldrich

MISSION® esiRNA

targeting human PRSS12

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCACAGCAGCACACTGTTTCAAGAGGTATGGCAACAGCACTAGGAGCTATGCTGTTAGGGTTGGAGATTATCATACTCTGGTACCAGAGGAGTTTGAGGAAGAAATTGGAGTTCAACAGATTGTGATTCATCGGGAGTATCGACCCGACCGCAGTGATTATGACATAGCCCTGGTTAGATTACAAGGACCAGAAGAGCAATGTGCCAGATTCAGCAGCCATGTTTTGCCAGCCTGTTTACCACTCTGGAGAGAGAGGCCACAGAAAACAGCATCCAACTGTTACATAACAGGATGGGGTGACACAGGACGAGCCTATTCAAGAACACTACAACAAGCAGCCATTCCCTTACTTCCTAAAAGGTTTTGTGAAGAACGTTATAAGGGTCGGTTTACAGGGAGAATGCTTTGTGCTGGAAACCTCCATGAACACAAACGCGTGGACAGCTGCCAGGGAGACAGCGGAGGACCACTCATGTGTGAACGGCCCGGAGAGAGCTGGGTGGTGTATGGGGTGACCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J J Souchek et al.
British journal of cancer, 111(6), 1139-1149 (2014-07-16)
Despite its promise as a highly useful therapy for pancreatic cancer (PC), the addition of external beam radiation therapy to PC treatment has shown varying success in clinical trials. Understanding PC radioresistance and discovery of methods to sensitise PC to
Judit Iván et al.
Stem cells and development, 26(23), 1724-1733 (2017-10-11)
Free fatty acid receptor 2 (FFAR2, also known as GPR43) is a G-protein-coupled receptor activated by short-chain fatty acids that are produced by gut microbiota through fermentation of nondigestible carbohydrates. FFAR2 functions as a metabolic sensor and is expressed in
Ah-Rong Nam et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(3), 886-900 (2018-10-05)
Jab1 is a coactivator of c-Jun that enhances the transcriptional function of c-Jun. Jab1 is frequently overexpressed in various cancers and is associatedwith poor prognosis of cancer patients. Thus, Jab1 could be a potential therapeutic target in cancer. However, the
Yang Zhang et al.
American journal of physiology. Lung cellular and molecular physiology, 307(2), L173-L185 (2014-05-20)
The inflammatory response is a primary mechanism in the pathogenesis of ventilator-induced lung injury. Autophagy is an essential, homeostatic process by which cells break down their own components. We explored the role of autophagy in the mechanisms of mechanical ventilation-induced
Shun-Yao Ko et al.
PloS one, 9(10), e110542-e110542 (2014-10-21)
Advanced glycation end products (AGEs) are produced in an irreversible non-enzymatic reaction of carbohydrates and proteins. Patients with diabetes mellitus (DM) are known to have elevated AGE levels, which is viewed as a risk factor of diabetes-related complications. In a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service