Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU125271

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAUR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

K D Rysenkova et al.
Cellular signalling, 75, 109741-109741 (2020-08-22)
Urokinase-type plasminogen activator uPA and its receptor (uPAR) are the central players in extracellular matrix proteolysis, which facilitates cancer invasion and metastasis. EGFR is one of the important components of uPAR interactome. uPAR/EGFR interaction controls signaling pathways that regulate cell
Xin Li et al.
Oncotarget, 8(51), 88645-88657 (2017-11-29)
Dissection and understanding of the molecular pathways driving triple-negative breast cancer (TNBC) are urgently needed to develop efficient tailored therapies. Aside from cell invasion and metastasis, the urokinase-type plasminogen activator receptor (uPAR) has been linked to apoptosis resistance in breast
Yohei Yamagami et al.
Biochemical and biophysical research communications, 525(3), 543-548 (2020-03-03)
There is increasing evidence that epithelial-mesenchymal transition (EMT) contributes to the development of organ fibrosis. We demonstrated that methotrexate (MTX) clearly induced EMT through the transforming growth factor (TGF)-β-related signaling pathway in human alveolar epithelial cell line, A549. However, critical
Xuexiang Gao et al.
Oncology letters, 16(3), 3983-3991 (2018-08-22)
Overexpression of urokinase-type plasminogen activator receptor (uPAR) has been implicated in promoting tumor invasion in various cancer types, including oral tongue squamous cell carcinoma (OTSCC); therefore, the effect of suppressing uPAR expression on the invasive and metastatic potential of OTSCC
Anna Laurenzana et al.
International journal of cancer, 141(6), 1190-1200 (2017-06-04)
In this manuscript, we show the involvement of the uPA/uPAR system in the regulation of aerobic glycolysis of melanoma cells. uPAR over-expression in human melanoma cells controls an invasive and glycolytic phenotype in normoxic conditions. uPAR down-regulation by siRNA or

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service