Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU125061

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCATGTGGTTTGGTTCCTCTCTGGTGGCTCTTTGGGCTGGTATTGGTGGCTTTCCTTGTGGCAGAGGATGTCTCAAACTTCAGATGGGAGGAAAGAGAGCAGGACTCACAGGTTGGAAGAGAATCACCTGGGAAAATACCAGAAAATGAGGGCCGCTTTGAGTCCCCCAGAGATGTCATCAGAGCTCCTCTGTCCTGCTTCTGAATGTGC

Ensembl | human accession no.

ENSG00000110680

NCBI accession no.

NM_001033952

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CALCA(796) , CALCA(796)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yin-Hung Chu et al.
Cells, 9(3) (2020-03-19)
Epithelial-mesenchymal transition (EMT) is strongly correlated with tumor metastasis and contains several protein markers, such as E-cadherin. Carbonic anhydrase III (CA III) exhibits low carbon dioxide hydratase activity in cancer. However, the detailed mechanisms of CA III and their roles
Yanjun Guo et al.
Peptides, 121, 170121-170121 (2019-08-07)
Endothelial dysfunction is considered to be an initial indicator in diabetes-induced macrovascular complications. Evidence has shown that CGRP is an important neuropeptide active in vascular system, especially in vasorelaxation. This study aimed to investigate the role of CGRP in high-glucose-induced
Ines Block et al.
Oncogene, 38(23), 4560-4573 (2019-02-14)
Breast cancer is a heterogeneous genetic disease driven by the accumulation of individual mutations per tumor. Whole-genome sequencing approaches have identified numerous genes with recurrent mutations in primary tumors. Although mutations in well characterized tumor suppressors and oncogenes are overrepresented
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively
John L Vahle et al.
Endocrinology, 156(7), 2409-2416 (2015-04-11)
Glucagon-like peptide-1 (GLP-1) receptor agonists, used for the treatment of type 2 diabetes, have caused hyperplasia/neoplasia of thyroid C cells in rodent carcinogenicity studies. Studies in monkeys have not identified an effect of GLP-1 receptor agonists on thyroid C cells;
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service