Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU123661

Sigma-Aldrich

MISSION® esiRNA

targeting human ANGPTL4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAGCCTGCAGACACAACTCAAGGCTCAGAACAGCAGGATCCAGCAACTCTTCCACAAGGTGGCCCAGCAGCAGCGGCACCTGGAGAAGCAGCACCTGCGAATTCAGCATCTGCAAAGCCAGTTTGGCCTCCTGGACCACAAGCACCTAGACCATGAGGTGGCCAAGCCTGCCCGAAGAAAGAGGCTGCCCGAGATGGCCCAGCCAGTTGACCCGGCTCACAATGTCAGCCGCCTGCACCGGCTGCCCAGGGATTGCCAGGAGCTGTTCCAGGTTGGGGAGAGGCAGAGTGGACTATTTGAAATCCAGCCTCAGGGGTCTCCGCCATTTTTGGTGAACTGCAAGATGACCTCAGATGGAGGCTGGACAGTAATTCAGAGGCGCCACGATGGCTCAGTGGACTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shinro Hata et al.
Oncology reports, 38(1), 120-128 (2017-06-01)
Angiopoietin-like protein 4 (ANGPTL4) is a multifunctional protein, playing roles in glucose and lipid metabolism, inflammation, angiogenesis, and tumorigenesis. Recent research suggests that ANGPTL4 is induced by hypoxia and is a useful diagnostic or prognostic marker for various cancers. However
William Yang et al.
Oncogene, 39(18), 3650-3665 (2020-03-07)
The BRAFV600E mutation occurs in more than 50% of cutaneous melanomas, and results in the constitutive activation of the mitogen-activated protein kinases (MAPK) pathway. MAP kinase-interacting serine/threonine-protein kinase 1 and 2 (MNK1/2) are downstream effectors of the activated MAPK pathway
Matthew R Richardson et al.
Angiogenesis, 17(3), 675-683 (2014-02-25)
Angiopoietin-like 2 (ANGPTL2) has been reported to induce sprouting angiogenesis; however, its role in vasculogenesis, the de novo lumenization of endothelial cells (EC), remains unexplored. We sought to investigate the potential role of ANGPTL2 in regulating human cord blood derived

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service