Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU122051

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)
Notify Me

Get notified when this item is ready to ship via email.

All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)
Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAACC

Ensembl | human accession no.

ENSG00000168610

NCBI accession no.

NM_003150

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STAT3(6774) , STAT3(6774)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
MBV
EZU
WVU
DIU
MDU

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Young Yun Jung et al.
Frontiers in pharmacology, 9, 531-531 (2018-06-15)
Because of the essential role of signal transducer and activator of transcription 3 (STAT3) in proliferation, anti-apoptosis, and chemoresistance of multiple myeloma (MM), we investigated whether icariin, a prenylated flavonol glycoside, inhibits both constitutive and inducible STAT3 activation in human
M Bam et al.
Translational psychiatry, 7(8), e1222-e1222 (2017-08-30)
Chronic inflammation is a characteristic of post-traumatic stress disorder (PTSD). The initiation of inflammation and molecules involved are not yet clearly understood. Here, we provide compelling evidence that the inflammation seen in PTSD may result from the dysregulated miRNA processing
Cong Liu et al.
Cell cycle (Georgetown, Tex.), 18(18), 2215-2227 (2019-07-10)
Various drug treatments including doxorubicin (DOX) have been proved efficient in the suppression of breast cancer. Nonetheless, drug resistance became an obstacle in the therapeutic process. According to recent literatures, breast cancer stem cells (BCSCs) were considered contributing to drug
Thijs S Stutvoet et al.
The Journal of pathology, 249(1), 52-64 (2019-04-12)
Immune checkpoint inhibitors targeting programmed cell death protein 1 (PD-1) and programmed death-ligand 1 (PD-L1) have improved the survival of patients with non-small cell lung cancer (NSCLC). Still, many patients do not respond to these inhibitors. PD-L1 (CD274) expression, one
Jong Hyun Lee et al.
Journal of advanced research, 26, 83-94 (2020-11-03)
Epithelial-mesenchymal transition (EMT) is a process of transdifferentiation where epithelial cells attain mesenchymal phenotype to gain invasive properties and thus, can contribute to metastasis of tumor cells. The antimetastatic and antitumor efficacy of brusatol (BT) was investigated in a hepatocellular
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service