Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU114041

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMD2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAGAAGTGGCTAAGGAGTGGCAGGAGCTGGATGACGCAGAGAAGGTCCAGCGGGAGCCTCTGCTCACTCTGGTGAAGGAAATCGTCCCCTATAACATGGCCCACAATGCAGAGCATGAGGCTTGCGACCTGCTTATGGAAATTGAGCAGGTGGACATGCTGGAGAAGGACATTGATGAAAATGCATATGCAAAGGTCTGCCTTTATCTCACCAGTTGTGTGAATTACGTGCCTGAGCCTGAGAACTCAGCCCTACTGCGTTGTGCCCTGGGTGTGTTCCGAAAGTTTAGCCGCTTCCCTGAAGCTCTGAGATTGGCATTGATGCTCAATGACATGGAGTTGGTAGAAGACATCTTCACCTCCTGCAAGGATGTGGTAGTACAGAAACAGATGGCATTCATGCTAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peter Tsvetkov et al.
Nature chemical biology, 15(7), 681-689 (2019-05-28)
The mechanisms by which cells adapt to proteotoxic stress are largely unknown, but are key to understanding how tumor cells, particularly in vivo, are largely resistant to proteasome inhibitors. Analysis of cancer cell lines, mouse xenografts and patient-derived tumor samples
Evert Njomen et al.
Cell chemical biology, 26(9), 1283-1294 (2019-07-23)
The proteolytic arm of the protein homeostasis network is maintained by both the ubiquitin-proteasome system (UPS) and autophagy. A well-balanced crosstalk between the two catabolic pathways ensures energy-efficient maintenance of cellular function. Our current understanding of the crosstalk between the
Christoph Gerhardt et al.
The Journal of cell biology, 210(1), 115-133 (2015-07-08)
Mutations in RPGRIP1L result in severe human diseases called ciliopathies. To unravel the molecular function of RPGRIP1L, we analyzed Rpgrip1l(-/-) mouse embryos, which display a ciliopathy phenotype and die, at the latest, around birth. In these embryos, cilia-mediated signaling was
Peter Tsvetkov et al.
eLife, 4 (2015-09-04)
Proteasomes are central regulators of protein homeostasis in eukaryotes. Proteasome function is vulnerable to environmental insults, cellular protein imbalance and targeted pharmaceuticals. Yet, mechanisms that cells deploy to counteract inhibition of this central regulator are little understood. To find such

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service