Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU113621

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2C

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACAAACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGCTCACT

Ensembl | human accession no.

ENSG00000081189

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MEF2C(4208) , MEF2C(4208)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hong-Ping Chen et al.
Journal of cellular physiology, 234(12), 23315-23325 (2019-05-30)
MicroRNAs (miRNAs) is a small molecule (19-25 nucleotide) noncoding RNA that inhibits the expression of target messenger RNA (mRNA) at the posttranscriptional level as an endogenous regulator. There is an increasing evidence that miR-199a-3p has a significant effect on the
Aleksandra Deczkowska et al.
Nature communications, 8(1), 717-717 (2017-09-30)
During ageing, microglia acquire a phenotype that may negatively affect brain function. Here we show that ageing microglial phenotype is largely imposed by interferon type I (IFN-I) chronically present in aged brain milieu. Overexpression of IFN-β in the CNS of
Mingliang Bai et al.
EMBO reports, 21(11), e50283-e50283 (2020-10-06)
A microdeletion within human chromosome 5q14.3 has been associated with the occurrence of neurodevelopmental disorders, such as autism and intellectual disability, and MEF2C haploinsufficiency was identified as main cause. Here, we report that a brain-enriched long non-coding RNA, NDIME, is located
Jing-Jing Zhang et al.
Molecular cancer, 13, 130-130 (2014-06-03)
Increasing evidence indicates an important role of transcription factor Yin Yang-1 (YY1) in human tumorigenesis. However, its function in cancer remains controversial and the relevance of YY1 to pancreatic ductal adenocarcinoma (PDAC) remains to be clarified. In this study, we
Qian Yu et al.
Neurochemical research, 45(4), 783-795 (2020-02-15)
Although many advances have been made in the pathogenesis of epilepsy recently, the pathological mechanisms of epilepsy are still largely unknown. Exploring the pathological mechanisms and developing novel therapeutic strategies for epilepsy are urgently needed. A SD rat model of
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service